Multiple sequence alignment - TraesCS2B01G282700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G282700 chr2B 100.000 2573 0 0 1 2573 391081499 391078927 0 4752
1 TraesCS2B01G282700 chr2B 96.325 517 15 3 2061 2573 175266301 175265785 0 846
2 TraesCS2B01G282700 chr2B 96.304 514 18 1 2061 2573 636518454 636518967 0 843
3 TraesCS2B01G282700 chr5A 98.837 2063 23 1 1 2062 19253497 19251435 0 3675
4 TraesCS2B01G282700 chr7B 98.739 2062 25 1 1 2061 716843188 716841127 0 3663
5 TraesCS2B01G282700 chr7B 98.691 2063 26 1 1 2062 716883429 716881367 0 3659
6 TraesCS2B01G282700 chr7B 98.497 2063 30 1 1 2062 742984796 742986858 0 3637
7 TraesCS2B01G282700 chr7A 98.547 2064 24 4 1 2062 120845800 120843741 0 3640
8 TraesCS2B01G282700 chr7A 98.352 2063 31 3 1 2062 60274666 60276726 0 3618
9 TraesCS2B01G282700 chr6D 98.546 2063 25 2 1 2062 124512886 124514944 0 3639
10 TraesCS2B01G282700 chr7D 98.497 2063 26 2 1 2062 203495361 203497419 0 3633
11 TraesCS2B01G282700 chr7D 98.400 2063 28 2 1 2062 381915340 381917398 0 3622
12 TraesCS2B01G282700 chr6B 97.271 513 13 1 2062 2573 493757055 493757567 0 869
13 TraesCS2B01G282700 chr6B 96.881 513 15 1 2062 2573 493765169 493765681 0 857
14 TraesCS2B01G282700 chr6B 96.325 517 15 3 2061 2573 467311695 467311179 0 846
15 TraesCS2B01G282700 chr3B 97.093 516 14 1 2059 2573 515237409 515236894 0 869
16 TraesCS2B01G282700 chr4B 97.076 513 15 0 2061 2573 176993201 176992689 0 865
17 TraesCS2B01G282700 chr1B 96.693 514 16 1 2061 2573 658167072 658167585 0 854
18 TraesCS2B01G282700 chr1B 96.498 514 17 1 2061 2573 326487757 326487244 0 848


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G282700 chr2B 391078927 391081499 2572 True 4752 4752 100.000 1 2573 1 chr2B.!!$R2 2572
1 TraesCS2B01G282700 chr2B 175265785 175266301 516 True 846 846 96.325 2061 2573 1 chr2B.!!$R1 512
2 TraesCS2B01G282700 chr2B 636518454 636518967 513 False 843 843 96.304 2061 2573 1 chr2B.!!$F1 512
3 TraesCS2B01G282700 chr5A 19251435 19253497 2062 True 3675 3675 98.837 1 2062 1 chr5A.!!$R1 2061
4 TraesCS2B01G282700 chr7B 716841127 716843188 2061 True 3663 3663 98.739 1 2061 1 chr7B.!!$R1 2060
5 TraesCS2B01G282700 chr7B 716881367 716883429 2062 True 3659 3659 98.691 1 2062 1 chr7B.!!$R2 2061
6 TraesCS2B01G282700 chr7B 742984796 742986858 2062 False 3637 3637 98.497 1 2062 1 chr7B.!!$F1 2061
7 TraesCS2B01G282700 chr7A 120843741 120845800 2059 True 3640 3640 98.547 1 2062 1 chr7A.!!$R1 2061
8 TraesCS2B01G282700 chr7A 60274666 60276726 2060 False 3618 3618 98.352 1 2062 1 chr7A.!!$F1 2061
9 TraesCS2B01G282700 chr6D 124512886 124514944 2058 False 3639 3639 98.546 1 2062 1 chr6D.!!$F1 2061
10 TraesCS2B01G282700 chr7D 203495361 203497419 2058 False 3633 3633 98.497 1 2062 1 chr7D.!!$F1 2061
11 TraesCS2B01G282700 chr7D 381915340 381917398 2058 False 3622 3622 98.400 1 2062 1 chr7D.!!$F2 2061
12 TraesCS2B01G282700 chr6B 493757055 493757567 512 False 869 869 97.271 2062 2573 1 chr6B.!!$F1 511
13 TraesCS2B01G282700 chr6B 493765169 493765681 512 False 857 857 96.881 2062 2573 1 chr6B.!!$F2 511
14 TraesCS2B01G282700 chr6B 467311179 467311695 516 True 846 846 96.325 2061 2573 1 chr6B.!!$R1 512
15 TraesCS2B01G282700 chr3B 515236894 515237409 515 True 869 869 97.093 2059 2573 1 chr3B.!!$R1 514
16 TraesCS2B01G282700 chr4B 176992689 176993201 512 True 865 865 97.076 2061 2573 1 chr4B.!!$R1 512
17 TraesCS2B01G282700 chr1B 658167072 658167585 513 False 854 854 96.693 2061 2573 1 chr1B.!!$F1 512
18 TraesCS2B01G282700 chr1B 326487244 326487757 513 True 848 848 96.498 2061 2573 1 chr1B.!!$R1 512

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
938 941 2.3606 CCCAACCGGCGATTTCCA 60.361 61.111 9.3 0.0 0.0 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2422 2429 0.394216 TCACAACAGTTGCAGGTGCT 60.394 50.0 13.56 0.0 42.66 4.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
264 265 4.646492 AGGCAACCCTTTAGATATTGCTTG 59.354 41.667 7.15 0.0 44.03 4.01
536 538 8.070034 TCGTTCCAGAACTCCTTAATAATACA 57.930 34.615 8.77 0.0 39.08 2.29
938 941 2.360600 CCCAACCGGCGATTTCCA 60.361 61.111 9.30 0.0 0.00 3.53
1199 1202 1.755621 CGGAGTGGATCATCCCTCTCA 60.756 57.143 20.65 0.0 44.47 3.27
1444 1447 6.940298 TCATCCATTACGAAAAGACTTTCCTT 59.060 34.615 0.00 0.0 38.17 3.36
1486 1489 5.480642 ACGCTATGATGATCCAGAGAAAT 57.519 39.130 2.77 0.0 0.00 2.17
1559 1562 0.324943 GCTAGTCCTTGGGAACAGCA 59.675 55.000 12.76 0.0 44.54 4.41
1836 1839 4.452825 TGATAGCAGAAGAGTACGCTAGT 58.547 43.478 0.00 0.0 40.10 2.57
1892 1895 3.135167 CCCCTACGGAAACTATTGCCTAA 59.865 47.826 0.00 0.0 0.00 2.69
2107 2110 1.817357 TCGAAGCACGACTTAGAGGA 58.183 50.000 2.09 0.0 46.45 3.71
2109 2112 2.555325 TCGAAGCACGACTTAGAGGAAA 59.445 45.455 2.09 0.0 46.45 3.13
2306 2313 4.298626 AGATAACCCAACTGCTAGATCCA 58.701 43.478 0.00 0.0 0.00 3.41
2312 2319 3.072038 CCCAACTGCTAGATCCATGATCA 59.928 47.826 0.00 0.0 41.12 2.92
2338 2345 2.025155 ACTGGGCTACACTACTGATCG 58.975 52.381 0.00 0.0 0.00 3.69
2422 2429 2.187100 TCACCTGCACTGGTATCATCA 58.813 47.619 0.00 0.0 38.45 3.07
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
125 126 2.418368 ATCATCCGCAGTTAAGGCAA 57.582 45.000 0.57 0.00 0.00 4.52
205 206 9.391006 CTTACCTATGCTTAAGATGTTTGGTAA 57.609 33.333 6.67 13.62 35.74 2.85
264 265 6.426937 TGATTAATAAAGATCAGCCTAACGCC 59.573 38.462 0.00 0.00 38.78 5.68
1199 1202 6.626302 TGGACAACTTCAAATCTTCGTTTTT 58.374 32.000 0.00 0.00 0.00 1.94
1444 1447 4.679639 GCGTACTTCCACATATCCACTCAA 60.680 45.833 0.00 0.00 0.00 3.02
1658 1661 1.289800 GACGCCCGTGGAAACTCTTC 61.290 60.000 0.00 0.00 0.00 2.87
1764 1767 4.524749 CTTTCGTATAGATCGAGACGCAA 58.475 43.478 16.73 12.04 38.52 4.85
1836 1839 1.296056 GCGTTTTCAGGCTCCGCTAA 61.296 55.000 0.00 0.00 41.06 3.09
1909 1912 6.494666 TCTTTTCTTCCCTTCTACTGACAA 57.505 37.500 0.00 0.00 0.00 3.18
2241 2246 4.524749 CGTAGTCGGACTATGTGTGTATG 58.475 47.826 23.30 4.16 33.98 2.39
2242 2247 4.808077 CGTAGTCGGACTATGTGTGTAT 57.192 45.455 23.30 0.00 33.98 2.29
2326 2333 4.082949 TCGTTTCATGTCGATCAGTAGTGT 60.083 41.667 0.00 0.00 0.00 3.55
2338 2345 4.549599 CGTTGCTATGTTTCGTTTCATGTC 59.450 41.667 0.00 0.00 0.00 3.06
2422 2429 0.394216 TCACAACAGTTGCAGGTGCT 60.394 50.000 13.56 0.00 42.66 4.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.