Multiple sequence alignment - TraesCS2B01G282600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G282600 chr2B 100.000 2207 0 0 1 2207 390976306 390974100 0.000000e+00 4076
1 TraesCS2B01G282600 chr2B 98.414 2207 34 1 1 2207 10667329 10669534 0.000000e+00 3880
2 TraesCS2B01G282600 chr2B 92.743 689 48 2 630 1317 588687074 588686387 0.000000e+00 994
3 TraesCS2B01G282600 chr2B 93.085 564 33 5 755 1317 588685795 588685237 0.000000e+00 821
4 TraesCS2B01G282600 chr2B 93.034 445 30 1 1 445 406246081 406245638 0.000000e+00 649
5 TraesCS2B01G282600 chr1B 98.005 1905 21 3 305 2207 674642311 674640422 0.000000e+00 3291
6 TraesCS2B01G282600 chr1B 94.444 432 22 2 2 433 198559985 198560414 0.000000e+00 664
7 TraesCS2B01G282600 chr5A 97.623 1767 40 2 442 2207 109300372 109302137 0.000000e+00 3029
8 TraesCS2B01G282600 chr5A 96.629 445 15 0 1 445 109299806 109300250 0.000000e+00 739
9 TraesCS2B01G282600 chr2A 97.566 1767 39 3 442 2207 130179353 130177590 0.000000e+00 3022
10 TraesCS2B01G282600 chr2A 95.955 445 18 0 1 445 130179919 130179475 0.000000e+00 723
11 TraesCS2B01G282600 chr7D 91.635 1566 99 10 442 1996 301662657 301661113 0.000000e+00 2137
12 TraesCS2B01G282600 chr7D 94.044 638 25 2 927 1564 46096344 46096968 0.000000e+00 955
13 TraesCS2B01G282600 chr7D 92.496 653 39 6 1564 2207 46101977 46102628 0.000000e+00 926
14 TraesCS2B01G282600 chr7D 93.506 385 21 3 442 825 46086186 46086567 8.840000e-159 569
15 TraesCS2B01G282600 chr7D 89.427 454 37 5 2 445 559672488 559672036 1.480000e-156 562
16 TraesCS2B01G282600 chr1D 93.445 1251 52 10 967 2207 252590495 252591725 0.000000e+00 1829
17 TraesCS2B01G282600 chr1D 95.848 289 7 3 461 744 252586049 252586337 1.540000e-126 462
18 TraesCS2B01G282600 chr1D 96.429 280 7 2 461 737 252573482 252573761 2.000000e-125 459
19 TraesCS2B01G282600 chr7A 93.301 1254 53 11 967 2207 665832345 665831110 0.000000e+00 1821
20 TraesCS2B01G282600 chr7A 90.783 434 36 2 13 445 673020820 673021250 5.280000e-161 577
21 TraesCS2B01G282600 chr4A 92.149 1261 59 13 967 2207 713137572 713136332 0.000000e+00 1744
22 TraesCS2B01G282600 chr6B 94.050 874 38 9 442 1314 26562197 26563057 0.000000e+00 1314
23 TraesCS2B01G282600 chr6A 92.281 868 35 9 451 1317 611534906 611534070 0.000000e+00 1203
24 TraesCS2B01G282600 chr6A 93.774 257 15 1 1952 2207 611533569 611533313 3.440000e-103 385
25 TraesCS2B01G282600 chr7B 93.077 390 25 1 56 445 620571839 620572226 8.840000e-159 569
26 TraesCS2B01G282600 chr7B 88.989 445 43 4 2 445 64482487 64482048 1.490000e-151 545


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G282600 chr2B 390974100 390976306 2206 True 4076.0 4076 100.0000 1 2207 1 chr2B.!!$R1 2206
1 TraesCS2B01G282600 chr2B 10667329 10669534 2205 False 3880.0 3880 98.4140 1 2207 1 chr2B.!!$F1 2206
2 TraesCS2B01G282600 chr2B 588685237 588687074 1837 True 907.5 994 92.9140 630 1317 2 chr2B.!!$R3 687
3 TraesCS2B01G282600 chr1B 674640422 674642311 1889 True 3291.0 3291 98.0050 305 2207 1 chr1B.!!$R1 1902
4 TraesCS2B01G282600 chr5A 109299806 109302137 2331 False 1884.0 3029 97.1260 1 2207 2 chr5A.!!$F1 2206
5 TraesCS2B01G282600 chr2A 130177590 130179919 2329 True 1872.5 3022 96.7605 1 2207 2 chr2A.!!$R1 2206
6 TraesCS2B01G282600 chr7D 301661113 301662657 1544 True 2137.0 2137 91.6350 442 1996 1 chr7D.!!$R1 1554
7 TraesCS2B01G282600 chr7D 46096344 46096968 624 False 955.0 955 94.0440 927 1564 1 chr7D.!!$F2 637
8 TraesCS2B01G282600 chr7D 46101977 46102628 651 False 926.0 926 92.4960 1564 2207 1 chr7D.!!$F3 643
9 TraesCS2B01G282600 chr1D 252590495 252591725 1230 False 1829.0 1829 93.4450 967 2207 1 chr1D.!!$F3 1240
10 TraesCS2B01G282600 chr7A 665831110 665832345 1235 True 1821.0 1821 93.3010 967 2207 1 chr7A.!!$R1 1240
11 TraesCS2B01G282600 chr4A 713136332 713137572 1240 True 1744.0 1744 92.1490 967 2207 1 chr4A.!!$R1 1240
12 TraesCS2B01G282600 chr6B 26562197 26563057 860 False 1314.0 1314 94.0500 442 1314 1 chr6B.!!$F1 872
13 TraesCS2B01G282600 chr6A 611533313 611534906 1593 True 794.0 1203 93.0275 451 2207 2 chr6A.!!$R1 1756

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
98 99 1.489649 CCAGGACTCTGCCTCATCAAT 59.51 52.381 0.0 0.0 39.61 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1556 1783 2.425539 TGCACGCATATCATGGTATGG 58.574 47.619 24.11 17.01 33.61 2.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
98 99 1.489649 CCAGGACTCTGCCTCATCAAT 59.510 52.381 0.00 0.0 39.61 2.57
300 301 5.789535 AGGATGTAGTTCTAGGGTGGTATT 58.210 41.667 0.00 0.0 0.00 1.89
449 575 2.224793 GGGCTCCTTTTTACAGTGAGGT 60.225 50.000 0.00 0.0 0.00 3.85
535 661 5.880332 TGTTTGCTTTCTGTAGTCTCAAAGT 59.120 36.000 0.00 0.0 0.00 2.66
1047 1194 2.040544 CGGCGCCTTCATGGACTTT 61.041 57.895 26.68 0.0 38.35 2.66
1241 1389 6.835819 AGTTATATCGCTATAAGCCTGACA 57.164 37.500 0.00 0.0 38.18 3.58
1427 1654 4.700700 TCTCTTGCTGTATGGTGATGATG 58.299 43.478 0.00 0.0 0.00 3.07
2035 2424 3.451141 TGTTTTGCATCAACTTGGTCC 57.549 42.857 9.91 0.0 0.00 4.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
82 83 5.423015 TCAAACTATTGATGAGGCAGAGTC 58.577 41.667 0.00 0.00 40.59 3.36
98 99 6.209192 ACTTCATGCAAATGGACATCAAACTA 59.791 34.615 0.00 0.00 0.00 2.24
300 301 8.753133 CAGGTAGATAGAAACCATGCTATATGA 58.247 37.037 0.00 0.00 38.30 2.15
535 661 2.857186 TTGCAGTGACCATTGCTCTA 57.143 45.000 16.43 2.44 43.39 2.43
1047 1194 2.571757 CAGAGGTCGGCGCTAACA 59.428 61.111 7.64 0.00 0.00 2.41
1222 1370 4.081476 TGCATGTCAGGCTTATAGCGATAT 60.081 41.667 11.26 0.00 43.62 1.63
1384 1537 3.061848 AAGCAATTGGTCGCCGGG 61.062 61.111 11.16 0.00 0.00 5.73
1556 1783 2.425539 TGCACGCATATCATGGTATGG 58.574 47.619 24.11 17.01 33.61 2.74


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.