Multiple sequence alignment - TraesCS2B01G269000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G269000 chr2B 100.000 4608 0 0 1 4608 364330668 364335275 0.000000e+00 8510.0
1 TraesCS2B01G269000 chr2B 98.072 4615 52 7 1 4608 770078149 770082733 0.000000e+00 7995.0
2 TraesCS2B01G269000 chr2B 95.704 4260 85 36 380 4608 798607930 798603738 0.000000e+00 6763.0
3 TraesCS2B01G269000 chr2B 89.670 4695 290 114 1 4608 717659320 717654734 0.000000e+00 5803.0
4 TraesCS2B01G269000 chr2B 93.046 417 11 11 4192 4608 45599151 45598753 1.100000e-165 593.0
5 TraesCS2B01G269000 chr2B 91.275 447 9 1 4192 4608 178344614 178345060 2.390000e-162 582.0
6 TraesCS2B01G269000 chr2B 90.828 447 11 1 4192 4608 563914012 563914458 5.170000e-159 571.0
7 TraesCS2B01G269000 chr2B 98.165 327 5 1 4282 4608 42196488 42196163 1.860000e-158 569.0
8 TraesCS2B01G269000 chr2B 98.095 105 2 0 4192 4296 29751466 29751570 2.830000e-42 183.0
9 TraesCS2B01G269000 chr1B 99.024 4609 31 3 1 4608 302765064 302769659 0.000000e+00 8250.0
10 TraesCS2B01G269000 chr3A 98.677 4610 34 5 1 4608 237060116 237055532 0.000000e+00 8150.0
11 TraesCS2B01G269000 chr7A 98.440 4614 49 6 1 4608 16012304 16007708 0.000000e+00 8100.0
12 TraesCS2B01G269000 chr2A 98.354 4616 52 6 1 4608 148608109 148612708 0.000000e+00 8082.0
13 TraesCS2B01G269000 chr2A 98.353 4615 51 8 1 4608 728941082 728936486 0.000000e+00 8078.0
14 TraesCS2B01G269000 chr2A 92.308 78 5 1 3880 3957 728937156 728937080 4.870000e-20 110.0
15 TraesCS2B01G269000 chr2A 94.444 36 1 1 4026 4061 14588084 14588118 2.000000e-03 54.7
16 TraesCS2B01G269000 chr5A 98.331 4614 54 6 1 4608 300962335 300957739 0.000000e+00 8072.0
17 TraesCS2B01G269000 chr3B 97.836 4621 53 8 1 4608 798605225 798609811 0.000000e+00 7936.0
18 TraesCS2B01G269000 chr5B 99.222 4239 32 1 371 4608 281825796 281830034 0.000000e+00 7644.0
19 TraesCS2B01G269000 chr5B 98.234 4360 51 11 258 4608 471287895 471292237 0.000000e+00 7601.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G269000 chr2B 364330668 364335275 4607 False 8510 8510 100.000 1 4608 1 chr2B.!!$F3 4607
1 TraesCS2B01G269000 chr2B 770078149 770082733 4584 False 7995 7995 98.072 1 4608 1 chr2B.!!$F5 4607
2 TraesCS2B01G269000 chr2B 798603738 798607930 4192 True 6763 6763 95.704 380 4608 1 chr2B.!!$R4 4228
3 TraesCS2B01G269000 chr2B 717654734 717659320 4586 True 5803 5803 89.670 1 4608 1 chr2B.!!$R3 4607
4 TraesCS2B01G269000 chr1B 302765064 302769659 4595 False 8250 8250 99.024 1 4608 1 chr1B.!!$F1 4607
5 TraesCS2B01G269000 chr3A 237055532 237060116 4584 True 8150 8150 98.677 1 4608 1 chr3A.!!$R1 4607
6 TraesCS2B01G269000 chr7A 16007708 16012304 4596 True 8100 8100 98.440 1 4608 1 chr7A.!!$R1 4607
7 TraesCS2B01G269000 chr2A 148608109 148612708 4599 False 8082 8082 98.354 1 4608 1 chr2A.!!$F2 4607
8 TraesCS2B01G269000 chr2A 728936486 728941082 4596 True 8078 8078 98.353 1 4608 1 chr2A.!!$R1 4607
9 TraesCS2B01G269000 chr5A 300957739 300962335 4596 True 8072 8072 98.331 1 4608 1 chr5A.!!$R1 4607
10 TraesCS2B01G269000 chr3B 798605225 798609811 4586 False 7936 7936 97.836 1 4608 1 chr3B.!!$F1 4607
11 TraesCS2B01G269000 chr5B 281825796 281830034 4238 False 7644 7644 99.222 371 4608 1 chr5B.!!$F1 4237
12 TraesCS2B01G269000 chr5B 471287895 471292237 4342 False 7601 7601 98.234 258 4608 1 chr5B.!!$F2 4350

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
123 124 0.739813 GGTTACGAAGCAGACGCCAT 60.740 55.0 0.00 0.00 39.83 4.40 F
568 575 5.931724 TGATGTGTAGTTGAACATGTAGGTG 59.068 40.0 0.00 0.00 37.15 4.00 F
1772 1867 5.505819 GCACTAGCATACTTGTATCGTCAGA 60.506 44.0 0.00 0.00 41.58 3.27 F
2520 2625 2.281762 GGTTCGATCGAAGGAACAATCG 59.718 50.0 29.79 12.67 43.29 3.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1532 1627 2.154462 CCAAGAATGCCTCACTTTCGT 58.846 47.619 0.00 0.0 37.48 3.85 R
2520 2625 5.245531 TGTTTGCCCAATCCGATATATCTC 58.754 41.667 10.93 0.0 0.00 2.75 R
2714 2819 0.832135 TCTGCAGTCTCCGGGTCTTT 60.832 55.000 14.67 0.0 0.00 2.52 R
3905 4068 0.176680 CGCCTGACTTACAGCCAGAT 59.823 55.000 0.00 0.0 44.52 2.90 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
123 124 0.739813 GGTTACGAAGCAGACGCCAT 60.740 55.000 0.00 0.00 39.83 4.40
488 495 8.221251 ACTAGGTGATGTTAGATGAGTAGATGA 58.779 37.037 0.00 0.00 0.00 2.92
568 575 5.931724 TGATGTGTAGTTGAACATGTAGGTG 59.068 40.000 0.00 0.00 37.15 4.00
1772 1867 5.505819 GCACTAGCATACTTGTATCGTCAGA 60.506 44.000 0.00 0.00 41.58 3.27
2520 2625 2.281762 GGTTCGATCGAAGGAACAATCG 59.718 50.000 29.79 12.67 43.29 3.34
2714 2819 0.963962 GTGGTCGGAGTTGGTGTCTA 59.036 55.000 0.00 0.00 0.00 2.59
2757 2862 4.224370 AGGTTATCATACCTTCAACACGGT 59.776 41.667 0.00 0.00 46.39 4.83
3186 3294 1.663695 GCCGCCAGAGCTAATAAACA 58.336 50.000 0.00 0.00 36.60 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
568 575 9.567848 ACATATACACAAAACCGAATTGATTTC 57.432 29.630 2.50 0.0 0.00 2.17
1532 1627 2.154462 CCAAGAATGCCTCACTTTCGT 58.846 47.619 0.00 0.0 37.48 3.85
2520 2625 5.245531 TGTTTGCCCAATCCGATATATCTC 58.754 41.667 10.93 0.0 0.00 2.75
2714 2819 0.832135 TCTGCAGTCTCCGGGTCTTT 60.832 55.000 14.67 0.0 0.00 2.52
3186 3294 2.230508 TCTTCGTTCTGGACATAACGCT 59.769 45.455 15.34 0.0 46.05 5.07
3399 3513 2.519771 TCTACCTTTCTGGCTCGGTA 57.480 50.000 0.00 0.0 40.22 4.02
3404 3518 5.770685 ATCTTCTTTCTACCTTTCTGGCT 57.229 39.130 0.00 0.0 40.22 4.75
3905 4068 0.176680 CGCCTGACTTACAGCCAGAT 59.823 55.000 0.00 0.0 44.52 2.90
3923 4086 3.047877 GACCCTGGCGTTTGGTCG 61.048 66.667 0.00 0.0 39.22 4.79


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.