Multiple sequence alignment - TraesCS2B01G260400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G260400 chr2B 100.000 2925 0 0 1 2925 327771513 327768589 0 5402
1 TraesCS2B01G260400 chr2B 98.530 2925 41 2 1 2925 563765234 563768156 0 5162
2 TraesCS2B01G260400 chr2B 98.462 2926 43 2 1 2925 106932289 106935213 0 5153
3 TraesCS2B01G260400 chr2B 98.325 2925 47 2 1 2925 257723647 257720725 0 5129
4 TraesCS2B01G260400 chr2B 98.120 2925 54 1 1 2925 63584153 63587076 0 5096
5 TraesCS2B01G260400 chr3B 98.427 2925 45 1 1 2925 717600181 717597258 0 5145
6 TraesCS2B01G260400 chr1B 98.427 2925 45 1 1 2925 26649580 26652503 0 5145
7 TraesCS2B01G260400 chr4B 98.360 2926 44 4 1 2925 11627560 11624638 0 5134
8 TraesCS2B01G260400 chr5B 98.325 2926 47 2 1 2925 36453480 36450556 0 5131
9 TraesCS2B01G260400 chr6B 98.154 2925 53 1 1 2925 586281838 586278915 0 5101


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G260400 chr2B 327768589 327771513 2924 True 5402 5402 100.000 1 2925 1 chr2B.!!$R2 2924
1 TraesCS2B01G260400 chr2B 563765234 563768156 2922 False 5162 5162 98.530 1 2925 1 chr2B.!!$F3 2924
2 TraesCS2B01G260400 chr2B 106932289 106935213 2924 False 5153 5153 98.462 1 2925 1 chr2B.!!$F2 2924
3 TraesCS2B01G260400 chr2B 257720725 257723647 2922 True 5129 5129 98.325 1 2925 1 chr2B.!!$R1 2924
4 TraesCS2B01G260400 chr2B 63584153 63587076 2923 False 5096 5096 98.120 1 2925 1 chr2B.!!$F1 2924
5 TraesCS2B01G260400 chr3B 717597258 717600181 2923 True 5145 5145 98.427 1 2925 1 chr3B.!!$R1 2924
6 TraesCS2B01G260400 chr1B 26649580 26652503 2923 False 5145 5145 98.427 1 2925 1 chr1B.!!$F1 2924
7 TraesCS2B01G260400 chr4B 11624638 11627560 2922 True 5134 5134 98.360 1 2925 1 chr4B.!!$R1 2924
8 TraesCS2B01G260400 chr5B 36450556 36453480 2924 True 5131 5131 98.325 1 2925 1 chr5B.!!$R1 2924
9 TraesCS2B01G260400 chr6B 586278915 586281838 2923 True 5101 5101 98.154 1 2925 1 chr6B.!!$R1 2924

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
239 240 2.920912 GGACCAGGACGACCACCA 60.921 66.667 6.71 0.0 38.94 4.17 F
1477 1478 0.892755 CCATGGTGCTGATGCTGTTT 59.107 50.000 2.57 0.0 40.48 2.83 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1841 1842 1.868997 CTGTTGCATCCGTTCGCTT 59.131 52.632 0.00 0.0 0.0 4.68 R
2826 2828 1.229359 CAGGATCATGGGCCAAGCT 59.771 57.895 11.89 0.0 0.0 3.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
177 178 7.391275 CACAGTGATCCATATACATGCCATTTA 59.609 37.037 0.00 0.00 0.00 1.40
239 240 2.920912 GGACCAGGACGACCACCA 60.921 66.667 6.71 0.00 38.94 4.17
755 756 4.974645 ATGGTAGTTTCCACTCTTCACA 57.025 40.909 0.00 0.00 40.51 3.58
1093 1094 9.740710 TCTATCATGCTTATAACTAGTGCTCTA 57.259 33.333 0.00 0.00 0.00 2.43
1101 1102 7.806014 GCTTATAACTAGTGCTCTACTCATGTC 59.194 40.741 0.00 0.00 40.89 3.06
1317 1318 1.271597 GCCTCAACATGTCCTGGAGTT 60.272 52.381 0.00 0.00 0.00 3.01
1477 1478 0.892755 CCATGGTGCTGATGCTGTTT 59.107 50.000 2.57 0.00 40.48 2.83
1543 1544 8.553459 TTAAGAGACATTTCTAGCTTTTCTGG 57.447 34.615 0.00 0.00 29.47 3.86
1680 1681 8.445275 TTGTAATATTTCACCTTCGTATGCAT 57.555 30.769 3.79 3.79 0.00 3.96
1791 1792 2.917933 TGCTTGTACTTGAAGCTGTGT 58.082 42.857 15.14 0.00 45.14 3.72
1841 1842 3.489355 GATGCATTGGTACCCATCATCA 58.511 45.455 21.01 11.29 36.30 3.07
2030 2031 2.734276 TTAGTATGCGTGTGCTGACA 57.266 45.000 0.00 0.00 43.34 3.58
2299 2300 6.015434 GCCCCAGTTTTTCTCATTCTTTTCTA 60.015 38.462 0.00 0.00 0.00 2.10
2366 2368 1.394618 GTCTCAGCCCTGACTATCGT 58.605 55.000 0.00 0.00 35.46 3.73
2695 2697 0.107165 GATGGGACCCACTTACCTGC 60.107 60.000 17.78 0.00 35.80 4.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
239 240 3.461773 CATCGCCGTGGAGGTCCT 61.462 66.667 0.00 0.0 43.70 3.85
755 756 3.813443 CTGCAGCATACTAATCTTGGGT 58.187 45.455 0.00 0.0 0.00 4.51
1042 1043 5.063880 GGCTGGGTGAAGAATATACGAAAT 58.936 41.667 0.00 0.0 0.00 2.17
1101 1102 5.238583 AGGAAGTGAAAATCCTGTCTAACG 58.761 41.667 0.00 0.0 44.38 3.18
1317 1318 4.235762 GAGGGCGGCGCTAATGGA 62.236 66.667 32.30 0.0 0.00 3.41
1567 1568 7.214381 TGTGTTAGCAGTAGTAAAACTCATGT 58.786 34.615 0.00 0.0 0.00 3.21
1680 1681 7.040340 TGCAGAATTCAAACCGAATAAACCTAA 60.040 33.333 8.44 0.0 43.83 2.69
1791 1792 6.287589 AGAACAAAACCACCAACATTAACA 57.712 33.333 0.00 0.0 0.00 2.41
1841 1842 1.868997 CTGTTGCATCCGTTCGCTT 59.131 52.632 0.00 0.0 0.00 4.68
2030 2031 7.168219 TCAACTGGCAAGATCTAACAATACTT 58.832 34.615 0.00 0.0 0.00 2.24
2299 2300 6.070021 TCCTCTGTCATCCTGTTACATGAATT 60.070 38.462 0.00 0.0 30.76 2.17
2826 2828 1.229359 CAGGATCATGGGCCAAGCT 59.771 57.895 11.89 0.0 0.00 3.74


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.