Multiple sequence alignment - TraesCS2B01G253800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G253800 chr2B 100.000 3092 0 0 1 3092 279190066 279186975 0.000000e+00 5710
1 TraesCS2B01G253800 chr2B 93.243 2738 161 17 360 3092 405161451 405164169 0.000000e+00 4010
2 TraesCS2B01G253800 chr2B 91.988 1922 136 13 1175 3092 575351695 575353602 0.000000e+00 2680
3 TraesCS2B01G253800 chr2B 86.897 1595 179 24 278 1861 298275598 298277173 0.000000e+00 1760
4 TraesCS2B01G253800 chr1B 91.325 2997 202 39 111 3092 475662604 475665557 0.000000e+00 4041
5 TraesCS2B01G253800 chr1B 95.433 1927 77 7 1175 3092 534468123 534470047 0.000000e+00 3061
6 TraesCS2B01G253800 chr1B 86.608 1710 196 21 159 1861 149476719 149475036 0.000000e+00 1858
7 TraesCS2B01G253800 chr1B 94.420 1147 61 3 1 1145 200994556 200995701 0.000000e+00 1760
8 TraesCS2B01G253800 chr3B 87.040 2963 332 39 160 3092 40494733 40497673 0.000000e+00 3297
9 TraesCS2B01G253800 chr3B 94.951 1921 63 21 1175 3092 289835698 289837587 0.000000e+00 2979
10 TraesCS2B01G253800 chr3B 86.581 1714 200 24 161 1861 115676152 115674456 0.000000e+00 1864
11 TraesCS2B01G253800 chr3B 86.814 1403 175 10 430 1829 376502024 376503419 0.000000e+00 1557
12 TraesCS2B01G253800 chr7B 87.008 2971 309 51 161 3092 518290409 518287477 0.000000e+00 3277
13 TraesCS2B01G253800 chr7B 88.787 437 41 7 1 434 550723331 550722900 2.110000e-146 529
14 TraesCS2B01G253800 chr4B 95.669 1778 69 6 1175 2949 207927364 207925592 0.000000e+00 2850
15 TraesCS2B01G253800 chr4B 91.813 1930 136 18 1175 3092 486847607 486845688 0.000000e+00 2669
16 TraesCS2B01G253800 chr4B 87.963 432 44 7 1 429 468760884 468760458 1.280000e-138 503
17 TraesCS2B01G253800 chrUn 86.825 1814 211 25 59 1861 41660524 41662320 0.000000e+00 2001
18 TraesCS2B01G253800 chrUn 86.962 1718 184 30 161 1861 79020539 79018845 0.000000e+00 1895
19 TraesCS2B01G253800 chr6B 89.583 432 37 6 1 429 182118091 182118517 2.710000e-150 542


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G253800 chr2B 279186975 279190066 3091 True 5710 5710 100.000 1 3092 1 chr2B.!!$R1 3091
1 TraesCS2B01G253800 chr2B 405161451 405164169 2718 False 4010 4010 93.243 360 3092 1 chr2B.!!$F2 2732
2 TraesCS2B01G253800 chr2B 575351695 575353602 1907 False 2680 2680 91.988 1175 3092 1 chr2B.!!$F3 1917
3 TraesCS2B01G253800 chr2B 298275598 298277173 1575 False 1760 1760 86.897 278 1861 1 chr2B.!!$F1 1583
4 TraesCS2B01G253800 chr1B 475662604 475665557 2953 False 4041 4041 91.325 111 3092 1 chr1B.!!$F2 2981
5 TraesCS2B01G253800 chr1B 534468123 534470047 1924 False 3061 3061 95.433 1175 3092 1 chr1B.!!$F3 1917
6 TraesCS2B01G253800 chr1B 149475036 149476719 1683 True 1858 1858 86.608 159 1861 1 chr1B.!!$R1 1702
7 TraesCS2B01G253800 chr1B 200994556 200995701 1145 False 1760 1760 94.420 1 1145 1 chr1B.!!$F1 1144
8 TraesCS2B01G253800 chr3B 40494733 40497673 2940 False 3297 3297 87.040 160 3092 1 chr3B.!!$F1 2932
9 TraesCS2B01G253800 chr3B 289835698 289837587 1889 False 2979 2979 94.951 1175 3092 1 chr3B.!!$F2 1917
10 TraesCS2B01G253800 chr3B 115674456 115676152 1696 True 1864 1864 86.581 161 1861 1 chr3B.!!$R1 1700
11 TraesCS2B01G253800 chr3B 376502024 376503419 1395 False 1557 1557 86.814 430 1829 1 chr3B.!!$F3 1399
12 TraesCS2B01G253800 chr7B 518287477 518290409 2932 True 3277 3277 87.008 161 3092 1 chr7B.!!$R1 2931
13 TraesCS2B01G253800 chr4B 207925592 207927364 1772 True 2850 2850 95.669 1175 2949 1 chr4B.!!$R1 1774
14 TraesCS2B01G253800 chr4B 486845688 486847607 1919 True 2669 2669 91.813 1175 3092 1 chr4B.!!$R3 1917
15 TraesCS2B01G253800 chrUn 41660524 41662320 1796 False 2001 2001 86.825 59 1861 1 chrUn.!!$F1 1802
16 TraesCS2B01G253800 chrUn 79018845 79020539 1694 True 1895 1895 86.962 161 1861 1 chrUn.!!$R1 1700

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
120 121 2.832129 TCTTCCCTCTGTCATACGCTTT 59.168 45.455 0.0 0.0 0.0 3.51 F
1065 1085 4.022329 CCACAACAGTTTTATTCACCTCCC 60.022 45.833 0.0 0.0 0.0 4.30 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1639 1660 0.037882 CCTGACACATCACGCTCTGT 60.038 55.0 0.0 0.0 0.0 3.41 R
2799 2858 0.834612 GGAACATACCACCGATCCCA 59.165 55.0 0.0 0.0 0.0 4.37 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
84 85 4.158949 TGACATGAAGCATTTTCATCCCTG 59.841 41.667 0.00 0.0 37.06 4.45
120 121 2.832129 TCTTCCCTCTGTCATACGCTTT 59.168 45.455 0.00 0.0 0.00 3.51
495 512 6.807789 AGGCTATAGACTAGGTTTTTCTTCG 58.192 40.000 6.23 0.0 0.00 3.79
970 990 6.763715 TGTCATATAGGAGCAATAACCCTT 57.236 37.500 0.00 0.0 0.00 3.95
1065 1085 4.022329 CCACAACAGTTTTATTCACCTCCC 60.022 45.833 0.00 0.0 0.00 4.30
1304 1325 8.820831 AGAGGAAATGAAGAAGATTAAGAGTGA 58.179 33.333 0.00 0.0 0.00 3.41
1568 1589 6.319048 AGTTGAAGATCCAATGTCTACCAT 57.681 37.500 0.00 0.0 34.36 3.55
1639 1660 8.750515 TGAGATTCATTTGCCTATTGTCATAA 57.249 30.769 0.00 0.0 0.00 1.90
2017 2041 4.702131 CCTATTTCAGGCTTTTGCTACTGT 59.298 41.667 0.00 0.0 46.54 3.55
2133 2157 4.411540 ACATATGGAAGAGTGAAGCTGGAT 59.588 41.667 7.80 0.0 0.00 3.41
2474 2531 8.982925 GAAAACTTGATCATTTTCTGCTTTTG 57.017 30.769 20.13 0.0 40.25 2.44
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
84 85 6.317391 CAGAGGGAAGAAACAAGATAATGGAC 59.683 42.308 0.0 0.0 0.00 4.02
720 740 3.633986 CCTCAAAAACTCCTTCTTGCTGT 59.366 43.478 0.0 0.0 0.00 4.40
970 990 5.133941 ACTAGAGGCAAACGATGAGATCTA 58.866 41.667 0.0 0.0 0.00 1.98
1065 1085 1.768275 TGGTGCTGGGGTATATGAGTG 59.232 52.381 0.0 0.0 0.00 3.51
1304 1325 4.984146 ACTTCTTCCACTAGCTCCTTTT 57.016 40.909 0.0 0.0 0.00 2.27
1568 1589 5.411669 GCATCTTCTTTTACTTCTTCGGGAA 59.588 40.000 0.0 0.0 0.00 3.97
1639 1660 0.037882 CCTGACACATCACGCTCTGT 60.038 55.000 0.0 0.0 0.00 3.41
1778 1799 0.819582 AGCAATGCCACCAATAGTGC 59.180 50.000 0.0 0.0 45.83 4.40
2017 2041 6.112734 CCTGGTCAGCATGTAGTAAACAATA 58.887 40.000 0.0 0.0 42.70 1.90
2133 2157 1.213678 CCCTTGCTTCCTCATGGATGA 59.786 52.381 0.0 0.0 42.81 2.92
2474 2531 3.388024 TGGTGATCTAGGTGTATCAAGGC 59.612 47.826 0.0 0.0 34.06 4.35
2799 2858 0.834612 GGAACATACCACCGATCCCA 59.165 55.000 0.0 0.0 0.00 4.37
2949 3011 9.802039 AGAAATATGACTTTGTGGTTAAACCTA 57.198 29.630 0.0 0.0 39.58 3.08
2950 3012 8.576442 CAGAAATATGACTTTGTGGTTAAACCT 58.424 33.333 0.0 0.0 39.58 3.50
2955 3017 7.517614 TTGCAGAAATATGACTTTGTGGTTA 57.482 32.000 0.0 0.0 31.85 2.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.