Multiple sequence alignment - TraesCS2B01G249300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G249300 chr2B 100.000 2924 0 0 1 2924 257723647 257720724 0 5400
1 TraesCS2B01G249300 chr2B 98.564 2925 40 2 1 2924 563765234 563768157 0 5168
2 TraesCS2B01G249300 chr2B 98.428 2926 44 2 1 2924 106932289 106935214 0 5147
3 TraesCS2B01G249300 chr2B 98.325 2926 47 2 1 2924 327771513 327768588 0 5131
4 TraesCS2B01G249300 chr2B 98.222 2925 51 1 1 2924 63584153 63587077 0 5112
5 TraesCS2B01G249300 chr1B 98.427 2925 45 1 1 2924 26649580 26652504 0 5145
6 TraesCS2B01G249300 chr3B 98.393 2925 46 1 1 2924 717600181 717597257 0 5140
7 TraesCS2B01G249300 chr4B 98.325 2926 45 3 1 2924 11627560 11624637 0 5129
8 TraesCS2B01G249300 chr5B 98.291 2926 48 1 1 2924 36453480 36450555 0 5125


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G249300 chr2B 257720724 257723647 2923 True 5400 5400 100.000 1 2924 1 chr2B.!!$R1 2923
1 TraesCS2B01G249300 chr2B 563765234 563768157 2923 False 5168 5168 98.564 1 2924 1 chr2B.!!$F3 2923
2 TraesCS2B01G249300 chr2B 106932289 106935214 2925 False 5147 5147 98.428 1 2924 1 chr2B.!!$F2 2923
3 TraesCS2B01G249300 chr2B 327768588 327771513 2925 True 5131 5131 98.325 1 2924 1 chr2B.!!$R2 2923
4 TraesCS2B01G249300 chr2B 63584153 63587077 2924 False 5112 5112 98.222 1 2924 1 chr2B.!!$F1 2923
5 TraesCS2B01G249300 chr1B 26649580 26652504 2924 False 5145 5145 98.427 1 2924 1 chr1B.!!$F1 2923
6 TraesCS2B01G249300 chr3B 717597257 717600181 2924 True 5140 5140 98.393 1 2924 1 chr3B.!!$R1 2923
7 TraesCS2B01G249300 chr4B 11624637 11627560 2923 True 5129 5129 98.325 1 2924 1 chr4B.!!$R1 2923
8 TraesCS2B01G249300 chr5B 36450555 36453480 2925 True 5125 5125 98.291 1 2924 1 chr5B.!!$R1 2923

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
273 274 0.744874 ATGATGAAGCCTGCACATGC 59.255 50.0 0.0 0.0 42.5 4.06 F
1136 1137 0.251297 CACTTCCTGCCATCCCAACA 60.251 55.0 0.0 0.0 0.0 3.33 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1170 1171 1.002087 GCAAGGTACTGGTGCTACTGT 59.998 52.381 8.2 0.0 38.97 3.55 R
2403 2406 0.970937 TCGGTAGTCAGGGCTGGAAG 60.971 60.000 0.0 0.0 0.00 3.46 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
273 274 0.744874 ATGATGAAGCCTGCACATGC 59.255 50.000 0.00 0.00 42.50 4.06
721 722 3.581755 CATGTCAAAGCTGGGTTCAATG 58.418 45.455 0.00 0.00 0.00 2.82
1089 1090 8.307483 GCCTTCTATCATGCTTATAACTAGTGA 58.693 37.037 0.00 0.00 0.00 3.41
1136 1137 0.251297 CACTTCCTGCCATCCCAACA 60.251 55.000 0.00 0.00 0.00 3.33
1170 1171 5.685511 GCTTACAAGATTTTTCTTTGCACGA 59.314 36.000 0.00 0.00 0.00 4.35
1467 1468 2.143876 ATTGTTCCTACCATGGTGCC 57.856 50.000 28.17 10.43 0.00 5.01
1614 1615 7.093289 ACACAGAGAGTATTTACTACTGCCAAT 60.093 37.037 16.98 3.70 40.88 3.16
1691 1693 5.995897 ACCTTCGTATGCATAGGTTTATTCC 59.004 40.000 22.18 1.41 37.75 3.01
1753 1755 9.353999 AGTGTTTTTATCAACTTGTTTTCACTC 57.646 29.630 0.00 0.00 0.00 3.51
1859 1861 1.005037 AGCGAACGGATGCAACAGA 60.005 52.632 0.30 0.00 0.00 3.41
2403 2406 3.484229 GCGTGTTGTTCATCTGACTATGC 60.484 47.826 0.00 0.00 0.00 3.14
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
292 293 1.371183 GCACCACACTGAGGCACTA 59.629 57.895 0.00 0.00 41.55 2.74
660 661 5.245531 TCCATTGGTTGTCACAGAGATAAC 58.754 41.667 1.86 0.00 44.76 1.89
721 722 5.048013 GGAAACTACCATATATTGCCCAAGC 60.048 44.000 0.00 0.00 40.48 4.01
987 988 8.681486 ATCTTGTGTAAATGATGCTAGCAATA 57.319 30.769 23.54 14.09 0.00 1.90
1089 1090 4.223700 TCCTGTCTAACAACATGAGCAGAT 59.776 41.667 0.00 0.00 0.00 2.90
1170 1171 1.002087 GCAAGGTACTGGTGCTACTGT 59.998 52.381 8.20 0.00 38.97 3.55
1286 1287 3.630013 TTGAGGCCGAGCAGCAGT 61.630 61.111 0.00 0.00 0.00 4.40
1454 1455 1.893808 GCATCGGCACCATGGTAGG 60.894 63.158 19.28 7.55 40.72 3.18
1467 1468 7.453838 CACATATCATATTCTGAACAGCATCG 58.546 38.462 0.00 0.00 37.44 3.84
1614 1615 5.089970 AGCATGCATACAAAGTCTCTGTA 57.910 39.130 21.98 0.00 33.93 2.74
1691 1693 7.509050 TTTCATGTCATGCATAATTCAAACG 57.491 32.000 8.03 0.00 35.74 3.60
1736 1738 6.599244 TCAAGTGAGAGTGAAAACAAGTTGAT 59.401 34.615 10.54 0.00 0.00 2.57
1753 1755 9.973450 AGTACAAGCAAGTATATATCAAGTGAG 57.027 33.333 0.00 0.00 0.00 3.51
1787 1789 4.410555 ACAAAACCACCAACATTAACCCAT 59.589 37.500 0.00 0.00 0.00 4.00
1859 1861 4.333417 GCCATGAGCTTCTTGCCT 57.667 55.556 0.00 0.00 44.23 4.75
2403 2406 0.970937 TCGGTAGTCAGGGCTGGAAG 60.971 60.000 0.00 0.00 0.00 3.46


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.