Multiple sequence alignment - TraesCS2B01G235000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G235000 chr2B 100.000 2192 0 0 1 2192 234541159 234538968 0 4048
1 TraesCS2B01G235000 chr3A 98.540 2192 32 0 1 2192 495104759 495102568 0 3871
2 TraesCS2B01G235000 chr1A 98.358 2192 35 1 1 2192 278521195 278523385 0 3847
3 TraesCS2B01G235000 chrUn 98.130 2192 40 1 1 2192 217907669 217909859 0 3819
4 TraesCS2B01G235000 chr3B 98.130 2192 40 1 1 2192 6010765 6008575 0 3819
5 TraesCS2B01G235000 chr3B 98.131 2194 36 3 1 2192 92296731 92294541 0 3819
6 TraesCS2B01G235000 chr1B 98.084 2192 41 1 1 2192 619195330 619193140 0 3814
7 TraesCS2B01G235000 chr7A 97.947 2192 45 0 1 2192 563522097 563519906 0 3799
8 TraesCS2B01G235000 chr4A 97.765 2192 49 0 1 2192 67519499 67521690 0 3777


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G235000 chr2B 234538968 234541159 2191 True 4048 4048 100.000 1 2192 1 chr2B.!!$R1 2191
1 TraesCS2B01G235000 chr3A 495102568 495104759 2191 True 3871 3871 98.540 1 2192 1 chr3A.!!$R1 2191
2 TraesCS2B01G235000 chr1A 278521195 278523385 2190 False 3847 3847 98.358 1 2192 1 chr1A.!!$F1 2191
3 TraesCS2B01G235000 chrUn 217907669 217909859 2190 False 3819 3819 98.130 1 2192 1 chrUn.!!$F1 2191
4 TraesCS2B01G235000 chr3B 6008575 6010765 2190 True 3819 3819 98.130 1 2192 1 chr3B.!!$R1 2191
5 TraesCS2B01G235000 chr3B 92294541 92296731 2190 True 3819 3819 98.131 1 2192 1 chr3B.!!$R2 2191
6 TraesCS2B01G235000 chr1B 619193140 619195330 2190 True 3814 3814 98.084 1 2192 1 chr1B.!!$R1 2191
7 TraesCS2B01G235000 chr7A 563519906 563522097 2191 True 3799 3799 97.947 1 2192 1 chr7A.!!$R1 2191
8 TraesCS2B01G235000 chr4A 67519499 67521690 2191 False 3777 3777 97.765 1 2192 1 chr4A.!!$F1 2191

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
292 293 2.50213 TGTCAACCGGCAACCATATCTA 59.498 45.455 0.0 0.0 0.0 1.98 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1548 1551 3.062042 CGATCATCGGCTTTGATCATGA 58.938 45.455 19.84 0.0 46.39 3.07 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
171 172 3.382227 CAGGATGCATGCCAGTTTCATAA 59.618 43.478 16.68 0.00 0.00 1.90
292 293 2.502130 TGTCAACCGGCAACCATATCTA 59.498 45.455 0.00 0.00 0.00 1.98
301 302 4.634004 CGGCAACCATATCTAGAAACAACA 59.366 41.667 0.00 0.00 0.00 3.33
613 614 2.639065 GCCATCAACCTTCGAATGGTA 58.361 47.619 16.39 5.94 36.69 3.25
1485 1488 5.001874 TCGCTATGATCGTTACTGTATCCT 58.998 41.667 0.00 0.00 0.00 3.24
1548 1551 5.435686 TGTCCTAATCAAATGCCTAGTGT 57.564 39.130 0.00 0.00 0.00 3.55
1841 1844 2.695359 CGGTTCTTCGGAGGAATCAAA 58.305 47.619 12.78 0.00 0.00 2.69
2130 2133 3.885297 CTGCCATCTTATCCACGGAAAAT 59.115 43.478 0.00 0.00 0.00 1.82
2142 2145 1.732259 ACGGAAAATGCGTCAAGCTAG 59.268 47.619 0.00 0.00 41.66 3.42
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
171 172 2.122413 TGCCACTCCACCAGGTCT 60.122 61.111 0.00 0.0 35.89 3.85
292 293 8.650143 ACCAATATCCACTAATTGTTGTTTCT 57.350 30.769 0.00 0.0 32.34 2.52
301 302 7.987458 CAGTGACAGTACCAATATCCACTAATT 59.013 37.037 0.00 0.0 33.00 1.40
629 630 0.179073 CCAGAGGCGAATCCGTTCAT 60.179 55.000 0.00 0.0 40.77 2.57
842 843 1.691196 CCAGTCAGCCACCTTTTTGA 58.309 50.000 0.00 0.0 0.00 2.69
1485 1488 5.700832 ACACTTTGTCGCATCTCTTCAATAA 59.299 36.000 0.00 0.0 0.00 1.40
1548 1551 3.062042 CGATCATCGGCTTTGATCATGA 58.938 45.455 19.84 0.0 46.39 3.07
1841 1844 5.768980 TCAATGAAGAAGGGAGAAGTCAT 57.231 39.130 0.00 0.0 0.00 3.06


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.