Multiple sequence alignment - TraesCS2B01G232200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G232200 chr2B 100.000 2430 0 0 1 2430 229825848 229828277 0 4488
1 TraesCS2B01G232200 chr2B 93.005 1158 46 10 705 1843 454009434 454010575 0 1657
2 TraesCS2B01G232200 chr2B 92.328 1147 59 13 707 1843 82490453 82489326 0 1604
3 TraesCS2B01G232200 chr2B 95.424 590 24 2 1844 2430 150594156 150593567 0 937
4 TraesCS2B01G232200 chr2B 95.416 589 21 5 1844 2430 150588108 150587524 0 933
5 TraesCS2B01G232200 chr2B 95.093 591 22 4 1844 2430 229820540 229821127 0 924
6 TraesCS2B01G232200 chr1D 95.371 1145 44 6 703 1839 400879436 400880579 0 1812
7 TraesCS2B01G232200 chr5A 95.147 1154 35 7 705 1843 545751707 545750560 0 1801
8 TraesCS2B01G232200 chr5A 93.011 1159 58 4 705 1843 643381330 643382485 0 1670
9 TraesCS2B01G232200 chr6D 93.918 1151 43 10 713 1843 380812554 380811411 0 1712
10 TraesCS2B01G232200 chr7B 93.092 1158 45 10 705 1843 58077364 58078505 0 1663
11 TraesCS2B01G232200 chr7B 97.730 705 14 2 1 704 437614712 437614009 0 1212
12 TraesCS2B01G232200 chr7B 97.021 705 19 2 1 704 519835204 519834501 0 1184
13 TraesCS2B01G232200 chr7B 97.017 704 21 0 1 704 608709069 608709772 0 1184
14 TraesCS2B01G232200 chr7B 95.076 589 27 2 1844 2430 210548350 210547762 0 926
15 TraesCS2B01G232200 chr7B 95.085 590 25 3 1844 2430 437387698 437388286 0 926
16 TraesCS2B01G232200 chr7B 95.085 590 23 5 1844 2430 437381700 437382286 0 924
17 TraesCS2B01G232200 chr3B 91.681 1154 58 17 705 1845 777850394 777849266 0 1565
18 TraesCS2B01G232200 chr3B 97.159 704 20 0 1 704 193774860 193774157 0 1190
19 TraesCS2B01G232200 chr5B 91.301 1161 56 9 702 1843 278897269 278896135 0 1543
20 TraesCS2B01G232200 chr5B 97.167 706 18 2 1 704 316912030 316911325 0 1192
21 TraesCS2B01G232200 chr5B 95.060 587 26 2 1845 2430 22573348 22572764 0 920
22 TraesCS2B01G232200 chr5B 94.915 590 25 5 1845 2430 453646239 453646827 0 918
23 TraesCS2B01G232200 chr4B 97.872 705 13 2 1 704 454969846 454969143 0 1218
24 TraesCS2B01G232200 chr6B 97.155 703 18 2 1 703 495372242 495372942 0 1186
25 TraesCS2B01G232200 chr6B 97.021 705 20 1 1 704 184082527 184083231 0 1184
26 TraesCS2B01G232200 chr6B 97.021 705 20 1 1 704 278744573 278743869 0 1184
27 TraesCS2B01G232200 chr1B 94.595 592 27 4 1841 2430 316331294 316331882 0 911


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G232200 chr2B 229825848 229828277 2429 False 4488 4488 100.000 1 2430 1 chr2B.!!$F2 2429
1 TraesCS2B01G232200 chr2B 454009434 454010575 1141 False 1657 1657 93.005 705 1843 1 chr2B.!!$F3 1138
2 TraesCS2B01G232200 chr2B 82489326 82490453 1127 True 1604 1604 92.328 707 1843 1 chr2B.!!$R1 1136
3 TraesCS2B01G232200 chr2B 150593567 150594156 589 True 937 937 95.424 1844 2430 1 chr2B.!!$R3 586
4 TraesCS2B01G232200 chr2B 150587524 150588108 584 True 933 933 95.416 1844 2430 1 chr2B.!!$R2 586
5 TraesCS2B01G232200 chr2B 229820540 229821127 587 False 924 924 95.093 1844 2430 1 chr2B.!!$F1 586
6 TraesCS2B01G232200 chr1D 400879436 400880579 1143 False 1812 1812 95.371 703 1839 1 chr1D.!!$F1 1136
7 TraesCS2B01G232200 chr5A 545750560 545751707 1147 True 1801 1801 95.147 705 1843 1 chr5A.!!$R1 1138
8 TraesCS2B01G232200 chr5A 643381330 643382485 1155 False 1670 1670 93.011 705 1843 1 chr5A.!!$F1 1138
9 TraesCS2B01G232200 chr6D 380811411 380812554 1143 True 1712 1712 93.918 713 1843 1 chr6D.!!$R1 1130
10 TraesCS2B01G232200 chr7B 58077364 58078505 1141 False 1663 1663 93.092 705 1843 1 chr7B.!!$F1 1138
11 TraesCS2B01G232200 chr7B 437614009 437614712 703 True 1212 1212 97.730 1 704 1 chr7B.!!$R2 703
12 TraesCS2B01G232200 chr7B 519834501 519835204 703 True 1184 1184 97.021 1 704 1 chr7B.!!$R3 703
13 TraesCS2B01G232200 chr7B 608709069 608709772 703 False 1184 1184 97.017 1 704 1 chr7B.!!$F4 703
14 TraesCS2B01G232200 chr7B 210547762 210548350 588 True 926 926 95.076 1844 2430 1 chr7B.!!$R1 586
15 TraesCS2B01G232200 chr7B 437387698 437388286 588 False 926 926 95.085 1844 2430 1 chr7B.!!$F3 586
16 TraesCS2B01G232200 chr7B 437381700 437382286 586 False 924 924 95.085 1844 2430 1 chr7B.!!$F2 586
17 TraesCS2B01G232200 chr3B 777849266 777850394 1128 True 1565 1565 91.681 705 1845 1 chr3B.!!$R2 1140
18 TraesCS2B01G232200 chr3B 193774157 193774860 703 True 1190 1190 97.159 1 704 1 chr3B.!!$R1 703
19 TraesCS2B01G232200 chr5B 278896135 278897269 1134 True 1543 1543 91.301 702 1843 1 chr5B.!!$R2 1141
20 TraesCS2B01G232200 chr5B 316911325 316912030 705 True 1192 1192 97.167 1 704 1 chr5B.!!$R3 703
21 TraesCS2B01G232200 chr5B 22572764 22573348 584 True 920 920 95.060 1845 2430 1 chr5B.!!$R1 585
22 TraesCS2B01G232200 chr5B 453646239 453646827 588 False 918 918 94.915 1845 2430 1 chr5B.!!$F1 585
23 TraesCS2B01G232200 chr4B 454969143 454969846 703 True 1218 1218 97.872 1 704 1 chr4B.!!$R1 703
24 TraesCS2B01G232200 chr6B 495372242 495372942 700 False 1186 1186 97.155 1 703 1 chr6B.!!$F2 702
25 TraesCS2B01G232200 chr6B 184082527 184083231 704 False 1184 1184 97.021 1 704 1 chr6B.!!$F1 703
26 TraesCS2B01G232200 chr6B 278743869 278744573 704 True 1184 1184 97.021 1 704 1 chr6B.!!$R1 703
27 TraesCS2B01G232200 chr1B 316331294 316331882 588 False 911 911 94.595 1841 2430 1 chr1B.!!$F1 589

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
960 967 0.544595 AACCCAACTACTCGGCCTCT 60.545 55.0 0.0 0.0 0.0 3.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2160 2222 0.544223 GAGAGCCCCCTTCTTCTTCC 59.456 60.0 0.0 0.0 0.0 3.46 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
344 346 8.272173 TCATGCCATGATTAGACATATGATCAT 58.728 33.333 13.81 13.81 39.21 2.45
643 646 5.220605 CGGGATAAAAACGGACAGAGATTTC 60.221 44.000 0.00 0.00 0.00 2.17
878 885 5.504665 CGAGTAACCGAATACACCGAAGTAT 60.505 44.000 0.00 0.00 36.29 2.12
960 967 0.544595 AACCCAACTACTCGGCCTCT 60.545 55.000 0.00 0.00 0.00 3.69
1009 1022 3.730761 GCATCCGCATCCGCATCC 61.731 66.667 0.00 0.00 38.40 3.51
1055 1088 2.096819 CGCCGCAACAACTAACCATATT 59.903 45.455 0.00 0.00 0.00 1.28
1213 1260 1.965643 ACCTACAACGCACTCCTACAA 59.034 47.619 0.00 0.00 0.00 2.41
1440 1487 5.250543 TGTGATGGAATAAAGAAGGGAGTGA 59.749 40.000 0.00 0.00 0.00 3.41
1441 1488 6.069440 TGTGATGGAATAAAGAAGGGAGTGAT 60.069 38.462 0.00 0.00 0.00 3.06
1713 1761 1.308069 CCGAGACCCGAACCGAAGTA 61.308 60.000 0.00 0.00 41.76 2.24
1776 1824 4.319046 CCGATCGGTCAGCAAAATCTAATG 60.319 45.833 26.35 0.00 0.00 1.90
1797 1845 2.362717 GACCGATTTTTGTGGAAACCCA 59.637 45.455 0.00 0.00 0.00 4.51
1803 1851 3.922171 TTTTGTGGAAACCCAAAGCAT 57.078 38.095 0.00 0.00 35.07 3.79
1962 2015 9.080915 GCAAGAAAGCTAATTTTATGAGAAAGG 57.919 33.333 0.00 0.00 0.00 3.11
2056 2109 3.256879 TCTGAGAACGCAGAAACAGAGAT 59.743 43.478 5.84 0.00 41.65 2.75
2071 2124 9.599056 AGAAACAGAGATATAGATCCAATCTCA 57.401 33.333 22.08 0.00 45.28 3.27
2160 2222 2.499693 GGAGGAGGTCAAGGAAGAAGAG 59.500 54.545 0.00 0.00 0.00 2.85
2250 2313 0.670546 CCGCGATCTTCACCAACACT 60.671 55.000 8.23 0.00 0.00 3.55
2263 2326 1.721389 CCAACACTGTCGTCATCTTCG 59.279 52.381 0.00 0.00 0.00 3.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
399 402 4.826183 GCTTAATTCCTGCTCATCCTCAAT 59.174 41.667 0.00 0.0 0.00 2.57
401 404 3.457380 AGCTTAATTCCTGCTCATCCTCA 59.543 43.478 0.00 0.0 30.41 3.86
878 885 4.157840 TCTCGAGTCCATCAATTTCTTCGA 59.842 41.667 13.13 0.0 0.00 3.71
932 939 0.179001 GTAGTTGGGTTGTGGGCTGT 60.179 55.000 0.00 0.0 0.00 4.40
960 967 3.578716 CGGGAGAAGGATTTATGGCTCTA 59.421 47.826 0.00 0.0 0.00 2.43
1055 1088 3.779738 TGAGGAGTGAGAGAGAGAGATGA 59.220 47.826 0.00 0.0 0.00 2.92
1193 1240 1.624336 TGTAGGAGTGCGTTGTAGGT 58.376 50.000 0.00 0.0 0.00 3.08
1440 1487 0.037303 CCCAGATCCATGCGCCTAAT 59.963 55.000 4.18 0.0 0.00 1.73
1441 1488 1.451504 CCCAGATCCATGCGCCTAA 59.548 57.895 4.18 0.0 0.00 2.69
1776 1824 2.362717 TGGGTTTCCACAAAAATCGGTC 59.637 45.455 0.00 0.0 38.32 4.79
1922 1975 1.967319 TCTTGCGCCAAAAGAAGAGT 58.033 45.000 4.18 0.0 30.79 3.24
2056 2109 4.046489 AGCCCCTCTGAGATTGGATCTATA 59.954 45.833 6.17 0.0 40.38 1.31
2160 2222 0.544223 GAGAGCCCCCTTCTTCTTCC 59.456 60.000 0.00 0.0 0.00 3.46
2263 2326 2.019984 GAAGGTGATGGAGATGTTGGC 58.980 52.381 0.00 0.0 0.00 4.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.