Multiple sequence alignment - TraesCS2B01G229700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G229700 chr2B 100.000 2639 0 0 1 2639 225325804 225323166 0.000000e+00 4874
1 TraesCS2B01G229700 chr2B 89.457 1840 171 22 812 2639 664329675 664327847 0.000000e+00 2302
2 TraesCS2B01G229700 chr1B 96.642 2650 73 9 1 2639 359220720 359218076 0.000000e+00 4386
3 TraesCS2B01G229700 chr6B 94.927 1853 66 3 814 2639 717731239 717733090 0.000000e+00 2876
4 TraesCS2B01G229700 chr6B 93.668 1216 51 4 812 2002 147949876 147948662 0.000000e+00 1796
5 TraesCS2B01G229700 chr6B 88.040 1413 132 27 812 2197 567117376 567115974 0.000000e+00 1639
6 TraesCS2B01G229700 chr6B 96.098 820 32 0 1 820 147950729 147949910 0.000000e+00 1338
7 TraesCS2B01G229700 chr6B 95.366 820 37 1 1 820 142948782 142947964 0.000000e+00 1303
8 TraesCS2B01G229700 chr6B 82.456 171 27 3 1904 2072 717732479 717732648 2.120000e-31 147
9 TraesCS2B01G229700 chr4B 94.819 1853 70 13 812 2639 622502469 622500618 0.000000e+00 2867
10 TraesCS2B01G229700 chr4B 96.341 820 30 0 1 820 622503322 622502503 0.000000e+00 1349
11 TraesCS2B01G229700 chr4B 83.938 193 28 3 2006 2197 622501375 622501185 5.800000e-42 182
12 TraesCS2B01G229700 chr5B 89.348 1840 168 26 812 2638 529281267 529283091 0.000000e+00 2287
13 TraesCS2B01G229700 chr5B 88.602 1474 133 25 812 2280 575036921 575035478 0.000000e+00 1759
14 TraesCS2B01G229700 chr5B 96.829 820 26 0 1 820 659536098 659536917 0.000000e+00 1371
15 TraesCS2B01G229700 chr5B 95.244 820 38 1 1 820 649874452 649875270 0.000000e+00 1297
16 TraesCS2B01G229700 chr5B 81.011 890 111 40 1758 2638 649895068 649895908 0.000000e+00 654
17 TraesCS2B01G229700 chr5B 88.372 516 32 2 1725 2214 659546441 659546954 1.750000e-166 595
18 TraesCS2B01G229700 chr5B 93.733 367 20 1 2276 2639 575025523 575025157 4.970000e-152 547
19 TraesCS2B01G229700 chr5B 83.938 193 28 3 2006 2197 659546622 659546812 5.800000e-42 182
20 TraesCS2B01G229700 chr5B 82.564 195 27 6 1882 2072 659546746 659546937 5.840000e-37 165
21 TraesCS2B01G229700 chr5B 80.729 192 35 2 2007 2198 529282343 529282532 5.890000e-32 148
22 TraesCS2B01G229700 chr3D 88.584 1857 177 18 812 2639 558680114 558681964 0.000000e+00 2222
23 TraesCS2B01G229700 chr3D 95.588 816 36 0 1 816 558679261 558680076 0.000000e+00 1308
24 TraesCS2B01G229700 chr2D 88.732 1420 119 24 812 2199 12315260 12313850 0.000000e+00 1698
25 TraesCS2B01G229700 chr2D 96.098 820 32 0 1 820 12316101 12315282 0.000000e+00 1338
26 TraesCS2B01G229700 chr7B 90.986 1176 83 15 812 1983 36427258 36426102 0.000000e+00 1563
27 TraesCS2B01G229700 chr3B 95.610 820 36 0 1 820 71793799 71792980 0.000000e+00 1315
28 TraesCS2B01G229700 chr3B 89.861 720 47 3 1377 2072 10032856 10032139 0.000000e+00 902
29 TraesCS2B01G229700 chr4D 86.067 811 93 13 1843 2639 473876286 473875482 0.000000e+00 854


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G229700 chr2B 225323166 225325804 2638 True 4874.0 4874 100.000000 1 2639 1 chr2B.!!$R1 2638
1 TraesCS2B01G229700 chr2B 664327847 664329675 1828 True 2302.0 2302 89.457000 812 2639 1 chr2B.!!$R2 1827
2 TraesCS2B01G229700 chr1B 359218076 359220720 2644 True 4386.0 4386 96.642000 1 2639 1 chr1B.!!$R1 2638
3 TraesCS2B01G229700 chr6B 567115974 567117376 1402 True 1639.0 1639 88.040000 812 2197 1 chr6B.!!$R2 1385
4 TraesCS2B01G229700 chr6B 147948662 147950729 2067 True 1567.0 1796 94.883000 1 2002 2 chr6B.!!$R3 2001
5 TraesCS2B01G229700 chr6B 717731239 717733090 1851 False 1511.5 2876 88.691500 814 2639 2 chr6B.!!$F1 1825
6 TraesCS2B01G229700 chr6B 142947964 142948782 818 True 1303.0 1303 95.366000 1 820 1 chr6B.!!$R1 819
7 TraesCS2B01G229700 chr4B 622500618 622503322 2704 True 1466.0 2867 91.699333 1 2639 3 chr4B.!!$R1 2638
8 TraesCS2B01G229700 chr5B 575035478 575036921 1443 True 1759.0 1759 88.602000 812 2280 1 chr5B.!!$R2 1468
9 TraesCS2B01G229700 chr5B 659536098 659536917 819 False 1371.0 1371 96.829000 1 820 1 chr5B.!!$F3 819
10 TraesCS2B01G229700 chr5B 649874452 649875270 818 False 1297.0 1297 95.244000 1 820 1 chr5B.!!$F1 819
11 TraesCS2B01G229700 chr5B 529281267 529283091 1824 False 1217.5 2287 85.038500 812 2638 2 chr5B.!!$F4 1826
12 TraesCS2B01G229700 chr5B 649895068 649895908 840 False 654.0 654 81.011000 1758 2638 1 chr5B.!!$F2 880
13 TraesCS2B01G229700 chr5B 659546441 659546954 513 False 314.0 595 84.958000 1725 2214 3 chr5B.!!$F5 489
14 TraesCS2B01G229700 chr3D 558679261 558681964 2703 False 1765.0 2222 92.086000 1 2639 2 chr3D.!!$F1 2638
15 TraesCS2B01G229700 chr2D 12313850 12316101 2251 True 1518.0 1698 92.415000 1 2199 2 chr2D.!!$R1 2198
16 TraesCS2B01G229700 chr7B 36426102 36427258 1156 True 1563.0 1563 90.986000 812 1983 1 chr7B.!!$R1 1171
17 TraesCS2B01G229700 chr3B 71792980 71793799 819 True 1315.0 1315 95.610000 1 820 1 chr3B.!!$R2 819
18 TraesCS2B01G229700 chr3B 10032139 10032856 717 True 902.0 902 89.861000 1377 2072 1 chr3B.!!$R1 695
19 TraesCS2B01G229700 chr4D 473875482 473876286 804 True 854.0 854 86.067000 1843 2639 1 chr4D.!!$R1 796

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
331 332 0.447406 CTCGCATTTGATGACGGCAA 59.553 50.0 0.0 0.0 33.05 4.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1894 1999 0.969894 ATCCTACCGCCATAGTCTGC 59.03 55.0 0.0 0.0 0.0 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
330 331 1.980951 GCTCGCATTTGATGACGGCA 61.981 55.000 0.00 0.0 32.50 5.69
331 332 0.447406 CTCGCATTTGATGACGGCAA 59.553 50.000 0.00 0.0 33.05 4.52
567 569 4.290093 TGGATGATCTAGCTGGTTACACT 58.710 43.478 0.00 0.0 0.00 3.55
941 986 9.658475 TTGTTTTGTGTAATCACTCTTATTTCG 57.342 29.630 0.00 0.0 44.14 3.46
1226 1272 0.319813 TATGCACATGATCGGAGGCG 60.320 55.000 0.00 0.0 0.00 5.52
1237 1283 1.890041 CGGAGGCGACCAACAAACA 60.890 57.895 0.00 0.0 0.00 2.83
1241 1287 1.101049 AGGCGACCAACAAACACCTG 61.101 55.000 0.00 0.0 0.00 4.00
1514 1561 1.352156 CGAAAGAAACGCGAGGAGGG 61.352 60.000 15.93 0.0 38.93 4.30
1538 1585 0.663153 GCACGCAAAGAGAAGGTTGT 59.337 50.000 0.00 0.0 0.00 3.32
1604 1651 0.907486 CAAGAGGAGGATGAGGCACA 59.093 55.000 0.00 0.0 0.00 4.57
1894 1999 2.140717 GATATTTGAACCCTACCGCCG 58.859 52.381 0.00 0.0 0.00 6.46
2168 2284 1.623811 CTATGGCGGTAGGGTATGCTT 59.376 52.381 0.00 0.0 0.00 3.91
2573 2704 5.654497 CTTTGGATTAGGCTTTGGTTCATC 58.346 41.667 0.00 0.0 0.00 2.92
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
330 331 1.830477 TGCAAGTTTCTTGCCTTGGTT 59.170 42.857 24.93 0.0 44.32 3.67
331 332 1.484038 TGCAAGTTTCTTGCCTTGGT 58.516 45.000 24.93 0.0 44.32 3.67
512 514 8.495260 TCCTAAACCTCTTCTTTCTTCTTCTTT 58.505 33.333 0.00 0.0 0.00 2.52
567 569 3.252215 CGCTACCAAACTGTTTCATTCCA 59.748 43.478 2.13 0.0 0.00 3.53
1160 1206 2.289694 CCTTCCGTCCATGACTTCTTGT 60.290 50.000 0.00 0.0 0.00 3.16
1226 1272 2.687935 ACATCACAGGTGTTTGTTGGTC 59.312 45.455 0.00 0.0 0.00 4.02
1237 1283 1.980052 CCGGTGGTACATCACAGGT 59.020 57.895 11.49 0.0 41.34 4.00
1241 1287 2.234300 CCATACCGGTGGTACATCAC 57.766 55.000 19.93 0.0 41.34 3.06
1514 1561 1.301677 CTTCTCTTTGCGTGCCCTCC 61.302 60.000 0.00 0.0 0.00 4.30
1538 1585 1.293498 GCCCTCTCTTCTGCACGAA 59.707 57.895 0.00 0.0 0.00 3.85
1604 1651 2.179427 GCCCTTTGCCCTTCTTGTAAT 58.821 47.619 0.00 0.0 0.00 1.89
1846 1947 9.328845 ACAAAATGAAAGAAAGCAACATGTTAT 57.671 25.926 11.53 0.0 0.00 1.89
1894 1999 0.969894 ATCCTACCGCCATAGTCTGC 59.030 55.000 0.00 0.0 0.00 4.26
1999 2105 2.599757 GGCGGTAGGGTTCCCTTGT 61.600 63.158 16.05 0.0 37.64 3.16
2573 2704 4.864334 GGGCGGGTGATGCAGAGG 62.864 72.222 0.00 0.0 0.00 3.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.