Multiple sequence alignment - TraesCS2B01G217600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G217600 chr2B 100.000 2408 0 0 1 2408 206192585 206194992 0 4447
1 TraesCS2B01G217600 chr2B 97.469 2410 57 4 1 2408 372911239 372908832 0 4109
2 TraesCS2B01G217600 chr7B 97.550 2408 57 2 2 2408 703137027 703134621 0 4119
3 TraesCS2B01G217600 chr6B 97.509 2409 58 2 1 2408 604067176 604069583 0 4115
4 TraesCS2B01G217600 chr6B 97.426 2409 59 3 1 2408 391262485 391264891 0 4102
5 TraesCS2B01G217600 chr6B 97.386 2410 60 3 1 2408 612467762 612470170 0 4098
6 TraesCS2B01G217600 chr5B 97.509 2409 57 3 1 2408 648445890 648443484 0 4113
7 TraesCS2B01G217600 chr1B 97.468 2409 59 2 1 2408 363206649 363204242 0 4109
8 TraesCS2B01G217600 chrUn 97.385 2409 60 3 1 2408 67480717 67483123 0 4096
9 TraesCS2B01G217600 chr3B 97.385 2409 58 4 1 2408 721501855 721504259 0 4095


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G217600 chr2B 206192585 206194992 2407 False 4447 4447 100.000 1 2408 1 chr2B.!!$F1 2407
1 TraesCS2B01G217600 chr2B 372908832 372911239 2407 True 4109 4109 97.469 1 2408 1 chr2B.!!$R1 2407
2 TraesCS2B01G217600 chr7B 703134621 703137027 2406 True 4119 4119 97.550 2 2408 1 chr7B.!!$R1 2406
3 TraesCS2B01G217600 chr6B 604067176 604069583 2407 False 4115 4115 97.509 1 2408 1 chr6B.!!$F2 2407
4 TraesCS2B01G217600 chr6B 391262485 391264891 2406 False 4102 4102 97.426 1 2408 1 chr6B.!!$F1 2407
5 TraesCS2B01G217600 chr6B 612467762 612470170 2408 False 4098 4098 97.386 1 2408 1 chr6B.!!$F3 2407
6 TraesCS2B01G217600 chr5B 648443484 648445890 2406 True 4113 4113 97.509 1 2408 1 chr5B.!!$R1 2407
7 TraesCS2B01G217600 chr1B 363204242 363206649 2407 True 4109 4109 97.468 1 2408 1 chr1B.!!$R1 2407
8 TraesCS2B01G217600 chrUn 67480717 67483123 2406 False 4096 4096 97.385 1 2408 1 chrUn.!!$F1 2407
9 TraesCS2B01G217600 chr3B 721501855 721504259 2404 False 4095 4095 97.385 1 2408 1 chr3B.!!$F1 2407

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
329 331 0.318784 GGACAGTTCTTCGTGACGCT 60.319 55.0 0.0 0.0 0.0 5.07 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1476 1478 1.078426 CCCGAGGTGGAAGCGAAAT 60.078 57.895 0.0 0.0 42.0 2.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
132 134 2.576615 ACTTTTCCAGAAAGAGCGCTT 58.423 42.857 13.26 0.0 35.37 4.68
303 305 0.745845 GAGCGCCATGAATCACAGGT 60.746 55.000 2.29 0.0 0.00 4.00
329 331 0.318784 GGACAGTTCTTCGTGACGCT 60.319 55.000 0.00 0.0 0.00 5.07
477 479 0.907704 TATATGCCAGTAGCCCCCGG 60.908 60.000 0.00 0.0 42.71 5.73
488 490 1.598869 AGCCCCCGGGACTTAAAATA 58.401 50.000 26.32 0.0 37.50 1.40
730 732 2.501723 ACTAGATCCGGACAAGCAACAT 59.498 45.455 6.12 0.0 0.00 2.71
786 788 0.694771 ATGAAGGTGCAGCAGGAGAA 59.305 50.000 19.63 0.0 0.00 2.87
935 937 8.829612 GCAAATTCCTTTGAAAAGAAGAATTCA 58.170 29.630 8.44 0.0 45.16 2.57
1028 1030 3.279434 GTTCAACAGGTGACCAACTTCT 58.721 45.455 3.63 0.0 35.39 2.85
1419 1421 7.033530 TCAGTTGGTTTGACGATGTAATTTT 57.966 32.000 0.00 0.0 0.00 1.82
1476 1478 1.974265 TCATTTGTCTTTGCGGACCA 58.026 45.000 0.00 0.0 35.54 4.02
1751 1753 5.964288 AGCATCTGGGGGCTTATAAATAAA 58.036 37.500 0.00 0.0 36.92 1.40
1918 1921 1.208776 GGAACGTAGGGGTAAGCACAT 59.791 52.381 0.00 0.0 0.00 3.21
2285 2289 2.808543 GAGTCGGTTGTCAGATGCTTTT 59.191 45.455 0.00 0.0 0.00 2.27
2292 2296 4.631813 GGTTGTCAGATGCTTTTCGTAGAT 59.368 41.667 0.00 0.0 35.04 1.98
2386 2390 1.895020 TTGTCCGGCAGGCGTAGAAT 61.895 55.000 16.17 0.0 37.47 2.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
6 7 3.394836 ACTCCTCTTCCGCCTGCC 61.395 66.667 0.00 0.00 0.00 4.85
137 139 0.319900 CAACCTCTCCGGACACTGTG 60.320 60.000 0.00 6.19 36.31 3.66
303 305 1.006571 GAAGAACTGTCCGGCGACA 60.007 57.895 9.30 10.26 46.91 4.35
329 331 2.754375 GCCTCCGGGGAGAAACAA 59.246 61.111 16.29 0.00 44.53 2.83
668 670 0.882484 TTGTCAGATTCACGCCGCAA 60.882 50.000 0.00 0.00 0.00 4.85
730 732 1.135083 GCCTTTAGCTGACGCAGTAGA 60.135 52.381 0.00 0.00 39.29 2.59
786 788 1.620323 GGGCATCTTGGAGCTTGTTTT 59.380 47.619 0.00 0.00 0.00 2.43
967 969 1.000506 GCGACCTGTGAGAACACCTAA 59.999 52.381 0.00 0.00 45.40 2.69
1008 1010 3.541632 GAGAAGTTGGTCACCTGTTGAA 58.458 45.455 0.00 0.00 35.39 2.69
1028 1030 0.874390 GAACAATTGCACCAGCTCGA 59.126 50.000 5.05 0.00 42.74 4.04
1419 1421 7.442364 GCTAGAAGGCATCTTACATGTCATTTA 59.558 37.037 0.00 0.00 39.71 1.40
1476 1478 1.078426 CCCGAGGTGGAAGCGAAAT 60.078 57.895 0.00 0.00 42.00 2.17
1486 1488 2.347490 CTGTTGGGTCCCGAGGTG 59.653 66.667 2.65 0.00 0.00 4.00
1918 1921 4.666253 GCTGGGTTGCCTGGCTCA 62.666 66.667 21.03 11.56 0.00 4.26
2041 2044 5.433712 TCATTATACCTGGGGGCTTCTTTAA 59.566 40.000 0.00 0.00 35.63 1.52
2386 2390 2.288579 ACTTACAATGTCGGCGAACTCA 60.289 45.455 12.92 6.08 0.00 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.