Multiple sequence alignment - TraesCS2B01G217200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G217200 chr2B 100.000 2597 0 0 1 2597 205481131 205478535 0.000000e+00 4796.0
1 TraesCS2B01G217200 chr2B 99.688 961 3 0 1637 2597 205530640 205529680 0.000000e+00 1759.0
2 TraesCS2B01G217200 chr2B 98.179 659 7 4 1 656 205532304 205531648 0.000000e+00 1146.0
3 TraesCS2B01G217200 chr2B 100.000 104 0 0 1549 1652 205530762 205530659 2.640000e-45 193.0
4 TraesCS2B01G217200 chr2D 96.978 1092 27 3 694 1784 145672744 145673830 0.000000e+00 1829.0
5 TraesCS2B01G217200 chr2D 94.604 593 28 2 2009 2597 145674291 145674883 0.000000e+00 915.0
6 TraesCS2B01G217200 chr2D 94.323 229 12 1 1778 2005 145674013 145674241 1.480000e-92 350.0
7 TraesCS2B01G217200 chr2D 91.667 96 8 0 1778 1873 74967465 74967560 1.620000e-27 134.0
8 TraesCS2B01G217200 chr2D 81.818 121 20 2 679 799 199128456 199128338 1.640000e-17 100.0
9 TraesCS2B01G217200 chr2D 97.727 44 0 1 634 677 145672704 145672746 9.970000e-10 75.0
10 TraesCS2B01G217200 chr2A 95.396 847 24 9 867 1711 156527363 156526530 0.000000e+00 1334.0
11 TraesCS2B01G217200 chr2A 93.200 250 11 4 634 878 156528155 156527907 1.900000e-96 363.0
12 TraesCS2B01G217200 chr2A 85.417 96 12 2 707 802 196321124 196321031 5.910000e-17 99.0
13 TraesCS2B01G217200 chr2A 85.417 96 12 2 707 802 196347056 196346963 5.910000e-17 99.0
14 TraesCS2B01G217200 chr2A 83.333 96 14 2 707 802 196328763 196328670 1.280000e-13 87.9
15 TraesCS2B01G217200 chr3B 88.272 648 56 16 1 636 494400609 494399970 0.000000e+00 758.0
16 TraesCS2B01G217200 chr3B 88.310 633 58 13 14 635 762593811 762593184 0.000000e+00 745.0
17 TraesCS2B01G217200 chr7B 88.000 650 61 14 1 636 52508035 52507389 0.000000e+00 752.0
18 TraesCS2B01G217200 chr7B 87.616 646 58 13 3 635 578120020 578120656 0.000000e+00 730.0
19 TraesCS2B01G217200 chr7B 81.899 674 74 21 9 655 715283662 715283010 2.290000e-145 525.0
20 TraesCS2B01G217200 chr5B 88.281 640 55 13 1 632 148876881 148877508 0.000000e+00 749.0
21 TraesCS2B01G217200 chr5B 100.000 32 0 0 634 665 6681515 6681546 2.790000e-05 60.2
22 TraesCS2B01G217200 chr4B 87.850 642 61 13 2 635 527964114 527964746 0.000000e+00 737.0
23 TraesCS2B01G217200 chr4B 87.117 652 63 16 1 635 578345765 578346412 0.000000e+00 719.0
24 TraesCS2B01G217200 chr4B 86.983 653 61 19 1 635 578475814 578476460 0.000000e+00 713.0
25 TraesCS2B01G217200 chr3A 87.209 86 10 1 717 802 505035501 505035417 2.130000e-16 97.1
26 TraesCS2B01G217200 chr3A 100.000 32 0 0 636 667 225891847 225891816 2.790000e-05 60.2
27 TraesCS2B01G217200 chr4A 84.375 96 13 2 707 802 456416309 456416216 2.750000e-15 93.5
28 TraesCS2B01G217200 chr4A 84.375 96 13 2 707 802 586679499 586679406 2.750000e-15 93.5
29 TraesCS2B01G217200 chr4A 100.000 31 0 0 634 664 584033399 584033369 1.000000e-04 58.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G217200 chr2B 205478535 205481131 2596 True 4796.000000 4796 100.000 1 2597 1 chr2B.!!$R1 2596
1 TraesCS2B01G217200 chr2B 205529680 205532304 2624 True 1032.666667 1759 99.289 1 2597 3 chr2B.!!$R2 2596
2 TraesCS2B01G217200 chr2D 145672704 145674883 2179 False 792.250000 1829 95.908 634 2597 4 chr2D.!!$F2 1963
3 TraesCS2B01G217200 chr2A 156526530 156528155 1625 True 848.500000 1334 94.298 634 1711 2 chr2A.!!$R4 1077
4 TraesCS2B01G217200 chr3B 494399970 494400609 639 True 758.000000 758 88.272 1 636 1 chr3B.!!$R1 635
5 TraesCS2B01G217200 chr3B 762593184 762593811 627 True 745.000000 745 88.310 14 635 1 chr3B.!!$R2 621
6 TraesCS2B01G217200 chr7B 52507389 52508035 646 True 752.000000 752 88.000 1 636 1 chr7B.!!$R1 635
7 TraesCS2B01G217200 chr7B 578120020 578120656 636 False 730.000000 730 87.616 3 635 1 chr7B.!!$F1 632
8 TraesCS2B01G217200 chr7B 715283010 715283662 652 True 525.000000 525 81.899 9 655 1 chr7B.!!$R2 646
9 TraesCS2B01G217200 chr5B 148876881 148877508 627 False 749.000000 749 88.281 1 632 1 chr5B.!!$F2 631
10 TraesCS2B01G217200 chr4B 527964114 527964746 632 False 737.000000 737 87.850 2 635 1 chr4B.!!$F1 633
11 TraesCS2B01G217200 chr4B 578345765 578346412 647 False 719.000000 719 87.117 1 635 1 chr4B.!!$F2 634
12 TraesCS2B01G217200 chr4B 578475814 578476460 646 False 713.000000 713 86.983 1 635 1 chr4B.!!$F3 634

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
720 772 0.324645 ATCCCAAAATCAAGCGGGCT 60.325 50.0 0.0 0.0 38.68 5.19 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2296 3175 8.820933 CGAAGATAATTAGATTCACTCAAAGCA 58.179 33.333 11.1 0.0 0.0 3.91 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
704 756 2.170397 CCCAAATAGGCCCAAAACATCC 59.830 50.000 0.00 0.0 35.39 3.51
720 772 0.324645 ATCCCAAAATCAAGCGGGCT 60.325 50.000 0.00 0.0 38.68 5.19
954 1562 3.015383 CCCGATCCCCAAACCCAT 58.985 61.111 0.00 0.0 0.00 4.00
961 1569 3.068064 CCCAAACCCATCCACCGC 61.068 66.667 0.00 0.0 0.00 5.68
962 1570 3.439540 CCAAACCCATCCACCGCG 61.440 66.667 0.00 0.0 0.00 6.46
963 1571 2.671619 CAAACCCATCCACCGCGT 60.672 61.111 4.92 0.0 0.00 6.01
964 1572 2.359478 AAACCCATCCACCGCGTC 60.359 61.111 4.92 0.0 0.00 5.19
1257 1865 2.680913 CGCCTTCGCCTGTTTCCTG 61.681 63.158 0.00 0.0 0.00 3.86
1305 1913 1.741770 GCAGATCGTCCGCACCTTT 60.742 57.895 0.00 0.0 0.00 3.11
1476 2084 2.743928 GTGCAGGTGAAGCTCGGG 60.744 66.667 0.00 0.0 0.00 5.14
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
426 466 1.975680 TGGTCTTCCCTAGCTTTTCGT 59.024 47.619 0.00 0.0 0.00 3.85
695 747 3.432933 CCGCTTGATTTTGGGATGTTTTG 59.567 43.478 0.00 0.0 0.00 2.44
720 772 1.883275 CCGACATGTTTAGCCAACCAA 59.117 47.619 0.00 0.0 33.97 3.67
725 777 0.322098 CCCACCGACATGTTTAGCCA 60.322 55.000 0.00 0.0 0.00 4.75
802 854 0.321564 TGATATACGGGCCATGCTGC 60.322 55.000 4.39 0.0 0.00 5.25
861 914 3.181504 CCTAGGCCAAAATTACCGTTTCG 60.182 47.826 5.01 0.0 0.00 3.46
954 1562 2.043752 TAGGATGGACGCGGTGGA 60.044 61.111 12.47 0.0 0.00 4.02
961 1569 1.033574 GAGGTGGAGTAGGATGGACG 58.966 60.000 0.00 0.0 0.00 4.79
962 1570 1.415200 GGAGGTGGAGTAGGATGGAC 58.585 60.000 0.00 0.0 0.00 4.02
963 1571 0.106167 CGGAGGTGGAGTAGGATGGA 60.106 60.000 0.00 0.0 0.00 3.41
964 1572 0.106167 TCGGAGGTGGAGTAGGATGG 60.106 60.000 0.00 0.0 0.00 3.51
1257 1865 2.507324 GCGACGAGGCTGGAGAAC 60.507 66.667 2.65 0.0 0.00 3.01
2296 3175 8.820933 CGAAGATAATTAGATTCACTCAAAGCA 58.179 33.333 11.10 0.0 0.00 3.91


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.