Multiple sequence alignment - TraesCS2B01G190600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G190600 chr2B 100.000 2252 0 0 1 2252 166209292 166211543 0 4159
1 TraesCS2B01G190600 chr2B 94.504 928 47 4 1 926 140813016 140813941 0 1428
2 TraesCS2B01G190600 chr2B 94.384 926 45 6 1 924 247606779 247607699 0 1415
3 TraesCS2B01G190600 chr2B 94.181 928 49 5 1 926 64843659 64844583 0 1410
4 TraesCS2B01G190600 chr2B 94.181 928 49 5 1 926 748732172 748733096 0 1410
5 TraesCS2B01G190600 chr2B 94.696 641 34 0 1612 2252 201431916 201431276 0 996
6 TraesCS2B01G190600 chr3B 94.935 928 43 4 1 926 493566180 493567105 0 1450
7 TraesCS2B01G190600 chr3B 94.397 928 48 4 4 929 261751983 261751058 0 1423
8 TraesCS2B01G190600 chr3B 97.372 685 16 2 930 1613 201505920 201505237 0 1164
9 TraesCS2B01G190600 chr4B 94.289 928 47 6 4 929 398585812 398584889 0 1415
10 TraesCS2B01G190600 chr4B 94.696 641 33 1 1612 2252 575429714 575429075 0 994
11 TraesCS2B01G190600 chr1B 94.092 931 51 4 1 929 581400506 581399578 0 1411
12 TraesCS2B01G190600 chr1B 94.181 928 49 5 1 926 236915345 236916269 0 1410
13 TraesCS2B01G190600 chr2D 98.099 684 12 1 930 1613 628285025 628284343 0 1190
14 TraesCS2B01G190600 chr2D 97.515 684 16 1 930 1613 334225267 334224585 0 1168
15 TraesCS2B01G190600 chr1D 98.099 684 12 1 930 1613 394177204 394176522 0 1190
16 TraesCS2B01G190600 chr1D 98.097 683 12 1 930 1612 394178257 394177576 0 1188
17 TraesCS2B01G190600 chr1D 97.515 684 16 1 930 1613 254489049 254488367 0 1168
18 TraesCS2B01G190600 chr3D 97.953 684 13 1 930 1613 21896909 21896227 0 1184
19 TraesCS2B01G190600 chr5D 97.807 684 14 1 930 1613 6208332 6209014 0 1179
20 TraesCS2B01G190600 chr5D 95.008 641 32 0 1612 2252 30459725 30460365 0 1007
21 TraesCS2B01G190600 chr1A 97.661 684 15 1 930 1613 554465681 554466363 0 1173
22 TraesCS2B01G190600 chr6D 95.164 641 31 0 1612 2252 407542965 407543605 0 1013
23 TraesCS2B01G190600 chr7B 95.008 641 32 0 1612 2252 125530350 125529710 0 1007
24 TraesCS2B01G190600 chr6B 94.852 641 33 0 1612 2252 255321776 255321136 0 1002
25 TraesCS2B01G190600 chr6B 94.860 642 32 1 1612 2252 347307804 347307163 0 1002
26 TraesCS2B01G190600 chr5B 94.852 641 33 0 1612 2252 652831713 652831073 0 1002
27 TraesCS2B01G190600 chr5B 94.696 641 34 0 1612 2252 262697500 262698140 0 996


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G190600 chr2B 166209292 166211543 2251 False 4159 4159 100.000 1 2252 1 chr2B.!!$F3 2251
1 TraesCS2B01G190600 chr2B 140813016 140813941 925 False 1428 1428 94.504 1 926 1 chr2B.!!$F2 925
2 TraesCS2B01G190600 chr2B 247606779 247607699 920 False 1415 1415 94.384 1 924 1 chr2B.!!$F4 923
3 TraesCS2B01G190600 chr2B 64843659 64844583 924 False 1410 1410 94.181 1 926 1 chr2B.!!$F1 925
4 TraesCS2B01G190600 chr2B 748732172 748733096 924 False 1410 1410 94.181 1 926 1 chr2B.!!$F5 925
5 TraesCS2B01G190600 chr2B 201431276 201431916 640 True 996 996 94.696 1612 2252 1 chr2B.!!$R1 640
6 TraesCS2B01G190600 chr3B 493566180 493567105 925 False 1450 1450 94.935 1 926 1 chr3B.!!$F1 925
7 TraesCS2B01G190600 chr3B 261751058 261751983 925 True 1423 1423 94.397 4 929 1 chr3B.!!$R2 925
8 TraesCS2B01G190600 chr3B 201505237 201505920 683 True 1164 1164 97.372 930 1613 1 chr3B.!!$R1 683
9 TraesCS2B01G190600 chr4B 398584889 398585812 923 True 1415 1415 94.289 4 929 1 chr4B.!!$R1 925
10 TraesCS2B01G190600 chr4B 575429075 575429714 639 True 994 994 94.696 1612 2252 1 chr4B.!!$R2 640
11 TraesCS2B01G190600 chr1B 581399578 581400506 928 True 1411 1411 94.092 1 929 1 chr1B.!!$R1 928
12 TraesCS2B01G190600 chr1B 236915345 236916269 924 False 1410 1410 94.181 1 926 1 chr1B.!!$F1 925
13 TraesCS2B01G190600 chr2D 628284343 628285025 682 True 1190 1190 98.099 930 1613 1 chr2D.!!$R2 683
14 TraesCS2B01G190600 chr2D 334224585 334225267 682 True 1168 1168 97.515 930 1613 1 chr2D.!!$R1 683
15 TraesCS2B01G190600 chr1D 394176522 394178257 1735 True 1189 1190 98.098 930 1613 2 chr1D.!!$R2 683
16 TraesCS2B01G190600 chr1D 254488367 254489049 682 True 1168 1168 97.515 930 1613 1 chr1D.!!$R1 683
17 TraesCS2B01G190600 chr3D 21896227 21896909 682 True 1184 1184 97.953 930 1613 1 chr3D.!!$R1 683
18 TraesCS2B01G190600 chr5D 6208332 6209014 682 False 1179 1179 97.807 930 1613 1 chr5D.!!$F1 683
19 TraesCS2B01G190600 chr5D 30459725 30460365 640 False 1007 1007 95.008 1612 2252 1 chr5D.!!$F2 640
20 TraesCS2B01G190600 chr1A 554465681 554466363 682 False 1173 1173 97.661 930 1613 1 chr1A.!!$F1 683
21 TraesCS2B01G190600 chr6D 407542965 407543605 640 False 1013 1013 95.164 1612 2252 1 chr6D.!!$F1 640
22 TraesCS2B01G190600 chr7B 125529710 125530350 640 True 1007 1007 95.008 1612 2252 1 chr7B.!!$R1 640
23 TraesCS2B01G190600 chr6B 255321136 255321776 640 True 1002 1002 94.852 1612 2252 1 chr6B.!!$R1 640
24 TraesCS2B01G190600 chr6B 347307163 347307804 641 True 1002 1002 94.860 1612 2252 1 chr6B.!!$R2 640
25 TraesCS2B01G190600 chr5B 652831073 652831713 640 True 1002 1002 94.852 1612 2252 1 chr5B.!!$R1 640
26 TraesCS2B01G190600 chr5B 262697500 262698140 640 False 996 996 94.696 1612 2252 1 chr5B.!!$F1 640

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
749 752 0.188342 ACCCTTGTTGAGTGGCCAAT 59.812 50.0 7.24 5.98 0.0 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1966 3026 0.95396 GGTGTTCCAGGTGGCGTTAG 60.954 60.0 0.0 0.0 34.44 2.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
125 126 1.739035 CGATGCTAAAGGTTGCGGAGA 60.739 52.381 0.00 0.00 0.00 3.71
147 148 7.501892 GGAGATAGAAATCAAAAAGGAGCATCT 59.498 37.037 0.00 0.00 34.28 2.90
310 311 1.213296 ACAAAGGGACTGGTCACTGT 58.787 50.000 6.25 0.00 43.77 3.55
375 376 9.249053 TGGCAAAGTGAAAGGTATATTTGATAA 57.751 29.630 0.00 0.00 31.01 1.75
561 564 4.456253 CGCCGTCGACACGCTACT 62.456 66.667 17.16 0.00 45.29 2.57
745 748 1.181098 ATGCACCCTTGTTGAGTGGC 61.181 55.000 0.00 0.00 32.05 5.01
747 750 1.152777 CACCCTTGTTGAGTGGCCA 60.153 57.895 0.00 0.00 0.00 5.36
749 752 0.188342 ACCCTTGTTGAGTGGCCAAT 59.812 50.000 7.24 5.98 0.00 3.16
910 914 2.749076 TGCTGATGGTCTTTTGGAATCG 59.251 45.455 0.00 0.00 0.00 3.34
914 918 2.559698 TGGTCTTTTGGAATCGCTCA 57.440 45.000 0.00 0.00 0.00 4.26
926 930 6.940831 TGGAATCGCTCAATTATGAATCAA 57.059 33.333 0.00 0.00 34.49 2.57
1178 1719 2.289195 ACGAGTATTTCACGGAAAGCCA 60.289 45.455 0.00 0.00 34.92 4.75
1315 1856 0.109153 TGCGATGGCTGGCTATTCAT 59.891 50.000 0.15 0.00 40.82 2.57
1335 1876 6.202202 TCATGGACTAGCTGTACCTACTAT 57.798 41.667 0.00 0.00 0.00 2.12
1377 1918 3.093814 TCAGCAATGCAGTTCATCCAAT 58.906 40.909 8.35 0.00 33.40 3.16
1421 2478 9.823647 CTATAGAACTATGACACAATCAAACCT 57.176 33.333 0.00 0.00 41.93 3.50
1775 2833 7.333423 TCGTTATTTTCTTACCTTCACAGATGG 59.667 37.037 0.00 0.00 33.73 3.51
1782 2840 3.864789 ACCTTCACAGATGGTTTGAGT 57.135 42.857 0.00 0.00 36.85 3.41
1865 2924 5.673337 TTTCAGAGTGAAGTGGAAAATCG 57.327 39.130 0.00 0.00 37.70 3.34
1936 2995 4.411256 TTGAGTTACGAGTTTGGTCCTT 57.589 40.909 0.00 0.00 0.00 3.36
1966 3026 5.705609 ACAACATGGGATAGTTTCACAAC 57.294 39.130 0.00 0.00 42.29 3.32
2069 3129 4.119442 TGTCTCTTACTGATTTACCGCC 57.881 45.455 0.00 0.00 0.00 6.13
2159 3219 6.484364 TGAGATGATGCCTTATGAACTGTA 57.516 37.500 0.00 0.00 0.00 2.74
2218 3278 1.650912 GGCTGCGATGCTTATGTGG 59.349 57.895 0.00 0.00 0.00 4.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
125 126 9.118300 CACTAGATGCTCCTTTTTGATTTCTAT 57.882 33.333 0.00 0.00 0.00 1.98
168 169 5.197451 TGCCCTTTTTCTTGAAACTAGTGA 58.803 37.500 0.00 0.00 0.00 3.41
310 311 0.770557 ACCTGGGGCAGTTCCACTTA 60.771 55.000 0.00 0.00 39.70 2.24
327 328 4.081322 TCCTTCTTATCCGCCAAATACC 57.919 45.455 0.00 0.00 0.00 2.73
561 564 6.312529 ACTAATCCCGATGGTAGATGTAGAA 58.687 40.000 0.00 0.00 0.00 2.10
826 829 3.056607 GGCAGTCCACAAATAAGTTGCAT 60.057 43.478 0.00 0.00 41.31 3.96
898 902 7.389803 TTCATAATTGAGCGATTCCAAAAGA 57.610 32.000 0.00 0.00 32.27 2.52
926 930 5.373812 AGATGGGATCGACCAGTAAAAAT 57.626 39.130 0.93 0.00 45.20 1.82
1097 1101 4.066490 CGTACTGACAAATAACCAACCCA 58.934 43.478 0.00 0.00 0.00 4.51
1178 1719 5.939296 TCGGTTATTAACGGAATTCCTTGTT 59.061 36.000 22.05 19.85 37.72 2.83
1260 1801 7.182760 AGGATAGGTTCGATCTATGGTCATTA 58.817 38.462 11.88 0.00 0.00 1.90
1315 1856 7.729124 AAAAATAGTAGGTACAGCTAGTCCA 57.271 36.000 0.00 0.00 0.00 4.02
1512 2570 8.970859 AGTCTCTTTCTTTCTCTCAATTGAAA 57.029 30.769 9.88 0.00 0.00 2.69
1673 2731 2.030185 TCCAACAAGTCAGTAGCTCGTC 60.030 50.000 0.00 0.00 0.00 4.20
1803 2861 8.239314 TCAAATGTTTCAGACTTATGCTTCATC 58.761 33.333 0.00 0.00 0.00 2.92
1966 3026 0.953960 GGTGTTCCAGGTGGCGTTAG 60.954 60.000 0.00 0.00 34.44 2.34
2069 3129 3.866883 AAGCATAACCCCAAAACGATG 57.133 42.857 0.00 0.00 0.00 3.84


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.