Multiple sequence alignment - TraesCS2B01G190300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G190300 chr2B 100.000 2776 0 0 1 2776 165929377 165926602 0.000000e+00 5127.0
1 TraesCS2B01G190300 chr2B 96.740 2699 79 7 1 2694 165779698 165777004 0.000000e+00 4488.0
2 TraesCS2B01G190300 chr2B 97.727 88 2 0 2689 2776 165772958 165772871 4.790000e-33 152.0
3 TraesCS2B01G190300 chr2B 96.774 62 2 0 1 62 536465245 536465306 1.360000e-18 104.0
4 TraesCS2B01G190300 chr2B 95.000 60 3 0 3 62 487700886 487700945 8.190000e-16 95.3
5 TraesCS2B01G190300 chr2B 96.364 55 2 0 2722 2776 756291575 756291629 1.060000e-14 91.6
6 TraesCS2B01G190300 chr2B 100.000 33 0 0 65 97 7270766 7270734 8.300000e-06 62.1
7 TraesCS2B01G190300 chr2D 92.975 2790 176 13 3 2776 115150875 115148090 0.000000e+00 4048.0
8 TraesCS2B01G190300 chr2D 84.561 1561 212 18 885 2430 44139949 44138403 0.000000e+00 1520.0
9 TraesCS2B01G190300 chr2D 86.949 613 65 10 161 771 192139611 192140210 0.000000e+00 675.0
10 TraesCS2B01G190300 chr2D 83.683 668 94 12 96 758 511033434 511034091 1.410000e-172 616.0
11 TraesCS2B01G190300 chr2A 90.717 2790 213 19 3 2776 116699641 116696882 0.000000e+00 3675.0
12 TraesCS2B01G190300 chr2A 90.707 2744 212 22 48 2776 116832462 116829747 0.000000e+00 3615.0
13 TraesCS2B01G190300 chr2A 89.503 181 19 0 885 1065 129232244 129232064 2.150000e-56 230.0
14 TraesCS2B01G190300 chr2A 92.453 53 4 0 885 937 116831672 116831620 2.960000e-10 76.8
15 TraesCS2B01G190300 chr7A 86.619 695 81 9 96 784 30158038 30157350 0.000000e+00 758.0
16 TraesCS2B01G190300 chr7A 84.627 683 90 12 96 771 421486631 421487305 0.000000e+00 665.0
17 TraesCS2B01G190300 chr7A 92.857 42 2 1 55 95 531745051 531745092 2.990000e-05 60.2
18 TraesCS2B01G190300 chr4A 85.578 735 84 9 885 1618 736968624 736969337 0.000000e+00 750.0
19 TraesCS2B01G190300 chr4A 85.578 735 84 9 885 1618 736995739 736996452 0.000000e+00 750.0
20 TraesCS2B01G190300 chr4A 100.000 33 0 0 65 97 407614773 407614805 8.300000e-06 62.1
21 TraesCS2B01G190300 chr7D 85.924 682 80 11 96 771 375036864 375037535 0.000000e+00 713.0
22 TraesCS2B01G190300 chr5B 96.774 62 2 0 1 62 349349782 349349843 1.360000e-18 104.0
23 TraesCS2B01G190300 chr7B 95.238 63 3 0 759 821 187599568 187599630 1.760000e-17 100.0
24 TraesCS2B01G190300 chr7B 97.872 47 1 0 2730 2776 527720414 527720368 6.370000e-12 82.4
25 TraesCS2B01G190300 chr7B 90.698 43 2 2 55 97 233706132 233706172 3.860000e-04 56.5
26 TraesCS2B01G190300 chr1A 96.552 58 2 0 4 61 293017404 293017347 2.280000e-16 97.1
27 TraesCS2B01G190300 chr1A 93.651 63 4 0 1 63 216606664 216606726 8.190000e-16 95.3
28 TraesCS2B01G190300 chr6A 95.000 60 3 0 3 62 284636249 284636308 8.190000e-16 95.3
29 TraesCS2B01G190300 chr3A 92.063 63 5 0 759 821 696406773 696406835 3.810000e-14 89.8
30 TraesCS2B01G190300 chr3A 91.489 47 4 0 2728 2774 550701858 550701904 6.420000e-07 65.8
31 TraesCS2B01G190300 chr3A 100.000 34 0 0 2741 2774 159342163 159342130 2.310000e-06 63.9
32 TraesCS2B01G190300 chr3D 100.000 39 0 0 2736 2774 141176816 141176778 3.840000e-09 73.1
33 TraesCS2B01G190300 chr3D 93.478 46 3 0 2729 2774 353856394 353856349 4.960000e-08 69.4
34 TraesCS2B01G190300 chr1D 95.556 45 2 0 2730 2774 197970303 197970259 3.840000e-09 73.1
35 TraesCS2B01G190300 chr1B 100.000 33 0 0 65 97 628612390 628612358 8.300000e-06 62.1
36 TraesCS2B01G190300 chr6B 90.909 44 4 0 2731 2774 448609562 448609605 2.990000e-05 60.2


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G190300 chr2B 165926602 165929377 2775 True 5127.0 5127 100.000 1 2776 1 chr2B.!!$R4 2775
1 TraesCS2B01G190300 chr2B 165777004 165779698 2694 True 4488.0 4488 96.740 1 2694 1 chr2B.!!$R3 2693
2 TraesCS2B01G190300 chr2D 115148090 115150875 2785 True 4048.0 4048 92.975 3 2776 1 chr2D.!!$R2 2773
3 TraesCS2B01G190300 chr2D 44138403 44139949 1546 True 1520.0 1520 84.561 885 2430 1 chr2D.!!$R1 1545
4 TraesCS2B01G190300 chr2D 192139611 192140210 599 False 675.0 675 86.949 161 771 1 chr2D.!!$F1 610
5 TraesCS2B01G190300 chr2D 511033434 511034091 657 False 616.0 616 83.683 96 758 1 chr2D.!!$F2 662
6 TraesCS2B01G190300 chr2A 116696882 116699641 2759 True 3675.0 3675 90.717 3 2776 1 chr2A.!!$R1 2773
7 TraesCS2B01G190300 chr2A 116829747 116832462 2715 True 1845.9 3615 91.580 48 2776 2 chr2A.!!$R3 2728
8 TraesCS2B01G190300 chr7A 30157350 30158038 688 True 758.0 758 86.619 96 784 1 chr7A.!!$R1 688
9 TraesCS2B01G190300 chr7A 421486631 421487305 674 False 665.0 665 84.627 96 771 1 chr7A.!!$F1 675
10 TraesCS2B01G190300 chr4A 736968624 736969337 713 False 750.0 750 85.578 885 1618 1 chr4A.!!$F2 733
11 TraesCS2B01G190300 chr4A 736995739 736996452 713 False 750.0 750 85.578 885 1618 1 chr4A.!!$F3 733
12 TraesCS2B01G190300 chr7D 375036864 375037535 671 False 713.0 713 85.924 96 771 1 chr7D.!!$F1 675

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
989 1013 2.040947 TGGCACAGACCATTTGGATGTA 59.959 45.455 3.01 0.0 37.07 2.29 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2134 2175 0.462375 GTCCAAGTTTGCCCCGTTTT 59.538 50.0 0.0 0.0 0.0 2.43 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
155 160 7.203910 ACCGAGTATTTTTGCACACATTTTTA 58.796 30.769 0.00 0.00 0.00 1.52
156 161 7.381139 ACCGAGTATTTTTGCACACATTTTTAG 59.619 33.333 0.00 0.00 0.00 1.85
346 353 3.430790 CCTGACATTCTTGAGTATCGCCA 60.431 47.826 0.00 0.00 38.61 5.69
973 997 3.008375 TCCATGGCTATAAGAGATGGCAC 59.992 47.826 6.96 0.00 37.79 5.01
989 1013 2.040947 TGGCACAGACCATTTGGATGTA 59.959 45.455 3.01 0.00 37.07 2.29
997 1021 6.375455 ACAGACCATTTGGATGTACATCTTTC 59.625 38.462 29.87 17.11 37.07 2.62
1417 1449 5.977129 GGGTGTGAAGTTATTGTCAAAACAG 59.023 40.000 10.96 0.00 36.57 3.16
1629 1663 9.023962 TCTAACTCATGCCAATGTTCTAAAAAT 57.976 29.630 0.00 0.00 35.15 1.82
1699 1733 2.687935 CAGCCTGGTAAAGTGTGTGTTT 59.312 45.455 0.00 0.00 0.00 2.83
1725 1759 8.902806 TCAAAAATGATGTGTTCTTAGTGACTT 58.097 29.630 0.00 0.00 0.00 3.01
1780 1819 1.035923 GATCATGAGACTCGCTCCCA 58.964 55.000 0.09 0.00 43.26 4.37
2134 2175 4.422073 ACCAGCCATAGATTCAAATCGA 57.578 40.909 0.00 0.00 40.35 3.59
2145 2186 1.319541 TCAAATCGAAAACGGGGCAA 58.680 45.000 0.00 0.00 0.00 4.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
155 160 6.311200 GCCATTCAAATGTTTAGAAATTCGCT 59.689 34.615 2.31 0.0 34.60 4.93
156 161 6.455513 GGCCATTCAAATGTTTAGAAATTCGC 60.456 38.462 0.00 0.0 34.60 4.70
346 353 0.905357 GTAGCCGGGCCTGATATCAT 59.095 55.000 17.02 0.0 0.00 2.45
973 997 6.457392 CGAAAGATGTACATCCAAATGGTCTG 60.457 42.308 28.26 7.4 38.58 3.51
989 1013 3.393089 AAGAGAGCACACGAAAGATGT 57.607 42.857 0.00 0.0 0.00 3.06
997 1021 1.071605 GGCAAGTAAGAGAGCACACG 58.928 55.000 0.00 0.0 0.00 4.49
1466 1498 1.689813 TCCTTGACAGCCTTAACACGA 59.310 47.619 0.00 0.0 0.00 4.35
1699 1733 8.450578 AGTCACTAAGAACACATCATTTTTGA 57.549 30.769 0.00 0.0 0.00 2.69
1780 1819 7.054124 TCACTTGGTGTTAGTTCAGAAAATCT 58.946 34.615 0.00 0.0 34.79 2.40
2072 2112 1.734655 ACCCATCAATATCGGCTCCT 58.265 50.000 0.00 0.0 0.00 3.69
2134 2175 0.462375 GTCCAAGTTTGCCCCGTTTT 59.538 50.000 0.00 0.0 0.00 2.43
2145 2186 4.746535 ATTTTGGTTTTCGGTCCAAGTT 57.253 36.364 0.00 0.0 43.28 2.66
2348 2389 9.412460 AGCATCTCCAACTATGAATTTTATCAA 57.588 29.630 0.00 0.0 32.06 2.57
2369 2410 8.887717 AGTTATCAAGTTCATTTGACTAGCATC 58.112 33.333 0.00 0.0 39.68 3.91
2587 2630 6.183360 GCAACGAATCTGCTTTAAAGTATCCT 60.183 38.462 16.38 0.0 36.84 3.24
2666 2709 1.852309 TCATGGTCCAGCCCACATTAT 59.148 47.619 0.00 0.0 37.31 1.28
2716 2759 6.780522 TCCTGCAATAGTGTATGGTGATACTA 59.219 38.462 0.00 0.0 36.20 1.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.