Multiple sequence alignment - TraesCS2B01G190000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G190000 chr2B 100.000 2606 0 0 1 2606 165276697 165279302 0.000000e+00 4813
1 TraesCS2B01G190000 chr2B 96.550 1826 42 10 798 2606 178741887 178743708 0.000000e+00 3003
2 TraesCS2B01G190000 chr3A 99.310 2610 14 4 1 2606 57277729 57275120 0.000000e+00 4717
3 TraesCS2B01G190000 chr5B 99.195 2610 17 4 1 2606 339081441 339084050 0.000000e+00 4700
4 TraesCS2B01G190000 chr7B 98.851 2610 26 4 1 2606 122624324 122626933 0.000000e+00 4650
5 TraesCS2B01G190000 chr7B 99.282 2368 13 1 1 2364 476795084 476792717 0.000000e+00 4276
6 TraesCS2B01G190000 chr5A 98.438 2625 22 6 1 2606 69232480 69229856 0.000000e+00 4602
7 TraesCS2B01G190000 chr4A 98.438 2625 22 6 1 2606 644772617 644769993 0.000000e+00 4602
8 TraesCS2B01G190000 chr1A 97.917 2640 20 6 1 2606 521287621 521284983 0.000000e+00 4538
9 TraesCS2B01G190000 chr1A 97.842 2641 21 7 1 2606 500074362 500071723 0.000000e+00 4529
10 TraesCS2B01G190000 chr3B 97.446 2623 28 7 1 2606 344147499 344144899 0.000000e+00 4436
11 TraesCS2B01G190000 chr3B 92.308 429 26 5 2026 2447 809208582 809208154 1.030000e-168 603
12 TraesCS2B01G190000 chr3B 84.266 572 71 16 2043 2606 33454077 33453517 8.200000e-150 540
13 TraesCS2B01G190000 chr3B 96.319 163 6 0 2444 2606 809207097 809206935 4.270000e-68 268
14 TraesCS2B01G190000 chr6A 98.150 2324 24 6 1 2305 97398496 97396173 0.000000e+00 4036
15 TraesCS2B01G190000 chr6B 94.165 1731 52 13 871 2583 245660405 245658706 0.000000e+00 2591


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G190000 chr2B 165276697 165279302 2605 False 4813.0 4813 100.0000 1 2606 1 chr2B.!!$F1 2605
1 TraesCS2B01G190000 chr2B 178741887 178743708 1821 False 3003.0 3003 96.5500 798 2606 1 chr2B.!!$F2 1808
2 TraesCS2B01G190000 chr3A 57275120 57277729 2609 True 4717.0 4717 99.3100 1 2606 1 chr3A.!!$R1 2605
3 TraesCS2B01G190000 chr5B 339081441 339084050 2609 False 4700.0 4700 99.1950 1 2606 1 chr5B.!!$F1 2605
4 TraesCS2B01G190000 chr7B 122624324 122626933 2609 False 4650.0 4650 98.8510 1 2606 1 chr7B.!!$F1 2605
5 TraesCS2B01G190000 chr7B 476792717 476795084 2367 True 4276.0 4276 99.2820 1 2364 1 chr7B.!!$R1 2363
6 TraesCS2B01G190000 chr5A 69229856 69232480 2624 True 4602.0 4602 98.4380 1 2606 1 chr5A.!!$R1 2605
7 TraesCS2B01G190000 chr4A 644769993 644772617 2624 True 4602.0 4602 98.4380 1 2606 1 chr4A.!!$R1 2605
8 TraesCS2B01G190000 chr1A 521284983 521287621 2638 True 4538.0 4538 97.9170 1 2606 1 chr1A.!!$R2 2605
9 TraesCS2B01G190000 chr1A 500071723 500074362 2639 True 4529.0 4529 97.8420 1 2606 1 chr1A.!!$R1 2605
10 TraesCS2B01G190000 chr3B 344144899 344147499 2600 True 4436.0 4436 97.4460 1 2606 1 chr3B.!!$R2 2605
11 TraesCS2B01G190000 chr3B 33453517 33454077 560 True 540.0 540 84.2660 2043 2606 1 chr3B.!!$R1 563
12 TraesCS2B01G190000 chr3B 809206935 809208582 1647 True 435.5 603 94.3135 2026 2606 2 chr3B.!!$R3 580
13 TraesCS2B01G190000 chr6A 97396173 97398496 2323 True 4036.0 4036 98.1500 1 2305 1 chr6A.!!$R1 2304
14 TraesCS2B01G190000 chr6B 245658706 245660405 1699 True 2591.0 2591 94.1650 871 2583 1 chr6B.!!$R1 1712

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
199 200 2.743718 CACCAGCTTCAGTCCGGT 59.256 61.111 0.0 0.0 0.0 5.28 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2024 2103 3.287222 AGTTGCTTCAGTTGTAGCCAAA 58.713 40.909 8.05 0.0 37.61 3.28 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
114 115 4.626081 GTCAGGTGCCACGCTGGT 62.626 66.667 11.70 0.00 40.46 4.00
199 200 2.743718 CACCAGCTTCAGTCCGGT 59.256 61.111 0.00 0.00 0.00 5.28
1480 1498 2.569404 ACCCAAGAGAAGCTAGAGTTGG 59.431 50.000 9.76 9.76 35.25 3.77
2024 2103 8.821686 TCCATTACAACTTGATCCATTACAAT 57.178 30.769 0.00 0.00 0.00 2.71
2364 2447 2.288666 CACAGCCACCGTGCTATTAAT 58.711 47.619 0.00 0.00 40.32 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
190 191 2.501223 GAATGGTGCGACCGGACTGA 62.501 60.000 9.46 2.04 42.58 3.41
199 200 3.407967 GGGAGGGGAATGGTGCGA 61.408 66.667 0.00 0.00 0.00 5.10
2024 2103 3.287222 AGTTGCTTCAGTTGTAGCCAAA 58.713 40.909 8.05 0.00 37.61 3.28
2364 2447 5.418524 AGCATGGTGAATTTGCTTGTGTATA 59.581 36.000 0.00 0.00 43.94 1.47


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.