Multiple sequence alignment - TraesCS2B01G178900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G178900 chr2B 100.000 2544 0 0 1 2544 153865103 153867646 0.000000e+00 4698
1 TraesCS2B01G178900 chr2B 95.632 1923 46 9 660 2544 717652711 717654633 0.000000e+00 3051
2 TraesCS2B01G178900 chr2B 97.002 1601 47 1 660 2259 45596647 45598247 0.000000e+00 2689
3 TraesCS2B01G178900 chr2B 98.964 676 5 2 1 675 717650122 717650796 0.000000e+00 1208
4 TraesCS2B01G178900 chr2B 98.669 676 7 2 1 675 45594158 45594832 0.000000e+00 1197
5 TraesCS2B01G178900 chr7B 96.092 1919 36 11 663 2544 130334623 130336539 0.000000e+00 3092
6 TraesCS2B01G178900 chr7B 95.738 1924 43 10 660 2544 235457435 235455512 0.000000e+00 3062
7 TraesCS2B01G178900 chr7B 98.669 676 7 2 1 675 328142325 328141651 0.000000e+00 1197
8 TraesCS2B01G178900 chr1B 95.525 1922 47 10 660 2544 550439439 550437520 0.000000e+00 3037
9 TraesCS2B01G178900 chr1B 98.817 676 6 2 1 675 550442027 550441353 0.000000e+00 1203
10 TraesCS2B01G178900 chr1B 97.778 225 3 1 2320 2544 357899746 357899524 1.100000e-103 387
11 TraesCS2B01G178900 chr4B 95.742 1879 50 11 660 2510 49106333 49108209 0.000000e+00 3000
12 TraesCS2B01G178900 chr5B 95.057 1922 55 11 660 2544 530940172 530938254 0.000000e+00 2987
13 TraesCS2B01G178900 chr5B 98.964 676 5 2 1 675 530942692 530942018 0.000000e+00 1208
14 TraesCS2B01G178900 chr5B 98.669 676 7 2 1 675 464632206 464632880 0.000000e+00 1197
15 TraesCS2B01G178900 chr5B 98.669 676 7 2 1 675 658082263 658082937 0.000000e+00 1197
16 TraesCS2B01G178900 chr5B 89.057 530 43 9 2030 2544 436478702 436479231 0.000000e+00 643
17 TraesCS2B01G178900 chr6B 93.916 1923 65 14 660 2544 114144169 114142261 0.000000e+00 2856
18 TraesCS2B01G178900 chr6B 94.536 1574 48 14 660 2223 661052274 661053819 0.000000e+00 2396
19 TraesCS2B01G178900 chr6B 98.817 676 6 2 1 675 114155126 114154452 0.000000e+00 1203
20 TraesCS2B01G178900 chr3B 96.829 1482 47 0 660 2141 803584072 803582591 0.000000e+00 2477
21 TraesCS2B01G178900 chr3B 92.226 1788 76 22 814 2544 393329884 393331665 0.000000e+00 2473
22 TraesCS2B01G178900 chr4A 98.964 676 5 2 1 675 712875578 712876252 0.000000e+00 1208
23 TraesCS2B01G178900 chr2A 90.000 650 50 9 1910 2544 728935736 728936385 0.000000e+00 826
24 TraesCS2B01G178900 chrUn 90.078 645 48 10 1916 2544 416567180 416566536 0.000000e+00 822
25 TraesCS2B01G178900 chr7A 89.862 651 50 10 1910 2544 16006957 16007607 0.000000e+00 822
26 TraesCS2B01G178900 chr6A 97.333 225 6 0 2320 2544 466681277 466681501 1.430000e-102 383


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G178900 chr2B 153865103 153867646 2543 False 4698.0 4698 100.0000 1 2544 1 chr2B.!!$F1 2543
1 TraesCS2B01G178900 chr2B 717650122 717654633 4511 False 2129.5 3051 97.2980 1 2544 2 chr2B.!!$F3 2543
2 TraesCS2B01G178900 chr2B 45594158 45598247 4089 False 1943.0 2689 97.8355 1 2259 2 chr2B.!!$F2 2258
3 TraesCS2B01G178900 chr7B 130334623 130336539 1916 False 3092.0 3092 96.0920 663 2544 1 chr7B.!!$F1 1881
4 TraesCS2B01G178900 chr7B 235455512 235457435 1923 True 3062.0 3062 95.7380 660 2544 1 chr7B.!!$R1 1884
5 TraesCS2B01G178900 chr7B 328141651 328142325 674 True 1197.0 1197 98.6690 1 675 1 chr7B.!!$R2 674
6 TraesCS2B01G178900 chr1B 550437520 550442027 4507 True 2120.0 3037 97.1710 1 2544 2 chr1B.!!$R2 2543
7 TraesCS2B01G178900 chr4B 49106333 49108209 1876 False 3000.0 3000 95.7420 660 2510 1 chr4B.!!$F1 1850
8 TraesCS2B01G178900 chr5B 530938254 530942692 4438 True 2097.5 2987 97.0105 1 2544 2 chr5B.!!$R1 2543
9 TraesCS2B01G178900 chr5B 464632206 464632880 674 False 1197.0 1197 98.6690 1 675 1 chr5B.!!$F2 674
10 TraesCS2B01G178900 chr5B 658082263 658082937 674 False 1197.0 1197 98.6690 1 675 1 chr5B.!!$F3 674
11 TraesCS2B01G178900 chr5B 436478702 436479231 529 False 643.0 643 89.0570 2030 2544 1 chr5B.!!$F1 514
12 TraesCS2B01G178900 chr6B 114142261 114144169 1908 True 2856.0 2856 93.9160 660 2544 1 chr6B.!!$R1 1884
13 TraesCS2B01G178900 chr6B 661052274 661053819 1545 False 2396.0 2396 94.5360 660 2223 1 chr6B.!!$F1 1563
14 TraesCS2B01G178900 chr6B 114154452 114155126 674 True 1203.0 1203 98.8170 1 675 1 chr6B.!!$R2 674
15 TraesCS2B01G178900 chr3B 803582591 803584072 1481 True 2477.0 2477 96.8290 660 2141 1 chr3B.!!$R1 1481
16 TraesCS2B01G178900 chr3B 393329884 393331665 1781 False 2473.0 2473 92.2260 814 2544 1 chr3B.!!$F1 1730
17 TraesCS2B01G178900 chr4A 712875578 712876252 674 False 1208.0 1208 98.9640 1 675 1 chr4A.!!$F1 674
18 TraesCS2B01G178900 chr2A 728935736 728936385 649 False 826.0 826 90.0000 1910 2544 1 chr2A.!!$F1 634
19 TraesCS2B01G178900 chrUn 416566536 416567180 644 True 822.0 822 90.0780 1916 2544 1 chrUn.!!$R1 628
20 TraesCS2B01G178900 chr7A 16006957 16007607 650 False 822.0 822 89.8620 1910 2544 1 chr7A.!!$F1 634

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
340 341 2.489073 GGGTCCAGTTGAACAGTTGGAT 60.489 50.0 7.86 0.0 41.41 3.41 F
1428 3389 0.392461 GATTGGTTACGGAGGCAGCA 60.392 55.0 0.00 0.0 0.00 4.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1480 3442 0.967887 TCTTGCGCTCACTAGCCTCT 60.968 55.000 9.73 0.0 46.68 3.69 R
2330 4516 3.245984 TGAAATGAGAGGGGTAGAGGTGA 60.246 47.826 0.00 0.0 0.00 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
340 341 2.489073 GGGTCCAGTTGAACAGTTGGAT 60.489 50.000 7.86 0.00 41.41 3.41
376 377 4.202716 ACAAAGGAGGAGAACCAAATCCAT 60.203 41.667 0.00 0.00 38.12 3.41
853 2814 5.307976 AGAGGAATGGTTGATAATGGATCGA 59.692 40.000 0.00 0.00 37.38 3.59
1008 2969 3.766545 TCTTTTTGTAGGCATGGCTTCT 58.233 40.909 28.30 5.85 0.00 2.85
1317 3278 8.773645 TGTCACTCATATGTCTAACAAAAACAG 58.226 33.333 1.90 0.00 0.00 3.16
1318 3279 8.774586 GTCACTCATATGTCTAACAAAAACAGT 58.225 33.333 1.90 0.00 0.00 3.55
1428 3389 0.392461 GATTGGTTACGGAGGCAGCA 60.392 55.000 0.00 0.00 0.00 4.41
1480 3442 2.257371 CGGGAGCGTCGTGAGAAA 59.743 61.111 0.00 0.00 45.01 2.52
1541 3503 1.609320 GCAAAGAGAAGGAGGCTCGTT 60.609 52.381 21.33 21.33 37.46 3.85
2133 4291 1.987855 CCAGACGCCAAGGTCCCTA 60.988 63.158 0.00 0.00 37.66 3.53
2159 4317 3.314331 CTCCCACACCCAGACGCT 61.314 66.667 0.00 0.00 0.00 5.07
2445 4637 5.011533 CCCTCAGATCTCTCATAAATCGGTT 59.988 44.000 0.00 0.00 0.00 4.44
2503 4695 3.655777 AGAAGGTAAATCAACTCCACCCA 59.344 43.478 0.00 0.00 0.00 4.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
340 341 3.054139 CCTCCTTTGTGAATCCATCCTCA 60.054 47.826 0.00 0.0 0.00 3.86
376 377 1.202710 TGTAAGCCCGTCAGCTCAAAA 60.203 47.619 0.00 0.0 44.11 2.44
1008 2969 2.280552 CCTCGTCCTGGAACCGGAA 61.281 63.158 9.46 0.0 31.13 4.30
1428 3389 3.158676 GCATAGGACTCCTCGAATAGGT 58.841 50.000 0.00 0.0 46.62 3.08
1480 3442 0.967887 TCTTGCGCTCACTAGCCTCT 60.968 55.000 9.73 0.0 46.68 3.69
1541 3503 5.568620 AGTTTTCTTGCCCTCTCTTCTTA 57.431 39.130 0.00 0.0 0.00 2.10
2026 4184 3.941188 CTGGCGTCTGGGTGTGGT 61.941 66.667 0.00 0.0 0.00 4.16
2133 4291 4.008933 GTGTGGGAGGCAGACGCT 62.009 66.667 0.00 0.0 38.60 5.07
2159 4317 2.363795 CAGACGCCAGGGTCCCTA 60.364 66.667 11.12 0.0 37.66 3.53
2330 4516 3.245984 TGAAATGAGAGGGGTAGAGGTGA 60.246 47.826 0.00 0.0 0.00 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.