Multiple sequence alignment - TraesCS2B01G170100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G170100 chr2B 100.000 2513 0 0 1 2513 143026812 143024300 0 4641
1 TraesCS2B01G170100 chr2B 96.505 2518 79 8 1 2513 692983948 692981435 0 4154
2 TraesCS2B01G170100 chr1B 97.421 2520 53 9 1 2513 592010706 592013220 0 4283
3 TraesCS2B01G170100 chr1B 95.792 2519 87 14 3 2513 87475273 87472766 0 4047
4 TraesCS2B01G170100 chr3B 96.467 2519 76 10 3 2513 577659244 577661757 0 4146
5 TraesCS2B01G170100 chr3B 96.271 2521 76 12 2 2513 31751054 31753565 0 4119
6 TraesCS2B01G170100 chr3B 96.267 2518 73 15 4 2513 434267156 434264652 0 4109
7 TraesCS2B01G170100 chr5B 96.430 2521 76 10 1 2513 192447632 192450146 0 4145
8 TraesCS2B01G170100 chr5B 95.800 2524 91 10 1 2513 281304022 281306541 0 4060
9 TraesCS2B01G170100 chr6B 96.393 2523 76 11 1 2513 690200147 690197630 0 4141


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G170100 chr2B 143024300 143026812 2512 True 4641 4641 100.000 1 2513 1 chr2B.!!$R1 2512
1 TraesCS2B01G170100 chr2B 692981435 692983948 2513 True 4154 4154 96.505 1 2513 1 chr2B.!!$R2 2512
2 TraesCS2B01G170100 chr1B 592010706 592013220 2514 False 4283 4283 97.421 1 2513 1 chr1B.!!$F1 2512
3 TraesCS2B01G170100 chr1B 87472766 87475273 2507 True 4047 4047 95.792 3 2513 1 chr1B.!!$R1 2510
4 TraesCS2B01G170100 chr3B 577659244 577661757 2513 False 4146 4146 96.467 3 2513 1 chr3B.!!$F2 2510
5 TraesCS2B01G170100 chr3B 31751054 31753565 2511 False 4119 4119 96.271 2 2513 1 chr3B.!!$F1 2511
6 TraesCS2B01G170100 chr3B 434264652 434267156 2504 True 4109 4109 96.267 4 2513 1 chr3B.!!$R1 2509
7 TraesCS2B01G170100 chr5B 192447632 192450146 2514 False 4145 4145 96.430 1 2513 1 chr5B.!!$F1 2512
8 TraesCS2B01G170100 chr5B 281304022 281306541 2519 False 4060 4060 95.800 1 2513 1 chr5B.!!$F2 2512
9 TraesCS2B01G170100 chr6B 690197630 690200147 2517 True 4141 4141 96.393 1 2513 1 chr6B.!!$R1 2512

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
571 587 0.328258 ATGCTCCAAACCCTAGCGTT 59.672 50.0 0.0 0.0 39.14 4.84 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1857 1876 1.068954 GCTTGTTTCTGGGCTTTCTCG 60.069 52.381 0.0 0.0 0.0 4.04 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
182 190 5.894393 TCTCTCCCTATTCTACAAACTCTGG 59.106 44.000 0.00 0.00 0.00 3.86
315 324 5.750547 TGCGCAAGAATTACAACATTTTGAA 59.249 32.000 8.16 0.00 43.02 2.69
571 587 0.328258 ATGCTCCAAACCCTAGCGTT 59.672 50.000 0.00 0.00 39.14 4.84
614 630 1.149627 AAGCGCCAAACACCACCTA 59.850 52.632 2.29 0.00 0.00 3.08
689 705 2.572290 CACTGTCCTTCTCGGGTTTTT 58.428 47.619 0.00 0.00 0.00 1.94
901 918 4.775780 TCTTTCCCCATCTTCTCGTTCTTA 59.224 41.667 0.00 0.00 0.00 2.10
935 952 4.764308 GCAATTCCTCTGTTTCTTCCTCTT 59.236 41.667 0.00 0.00 0.00 2.85
939 956 2.373502 CCTCTGTTTCTTCCTCTTGGGT 59.626 50.000 0.00 0.00 36.25 4.51
956 973 2.040178 GGGTGATATGTCGACCTCCTT 58.960 52.381 14.12 0.00 0.00 3.36
1128 1145 1.759459 CGGAGGGGCAGGTTAGATCC 61.759 65.000 0.00 0.00 0.00 3.36
1213 1231 7.390440 AGGTTACATGATTTCGTTTTCAGATCA 59.610 33.333 0.00 0.00 0.00 2.92
1435 1453 6.365970 AGAACTTCAAGGAGCTTATTGAGA 57.634 37.500 12.58 5.93 36.81 3.27
1483 1501 6.556874 AGCTTTAGGAATACTTGCTCTAGGAT 59.443 38.462 0.00 0.00 31.99 3.24
1728 1746 4.152647 TGGATCATACCTTAGCTCGTCAT 58.847 43.478 0.00 0.00 0.00 3.06
1857 1876 2.818274 CTAGTTCGCGGGCCCAAC 60.818 66.667 24.92 18.91 0.00 3.77
2343 2372 4.141914 TGTTTGGTTAATTTTTCCCACGCT 60.142 37.500 0.00 0.00 0.00 5.07
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
182 190 7.976135 ATGAGCTATCACCTATGAACATTTC 57.024 36.000 0.00 0.00 38.57 2.17
288 297 3.266541 TGTTGTAATTCTTGCGCACAG 57.733 42.857 11.12 11.55 0.00 3.66
486 502 6.537355 TGACCAAATTTCAAATGGCCATAAA 58.463 32.000 21.15 16.49 37.77 1.40
504 520 3.561744 CGGGGTTATTAGGGTTTGACCAA 60.562 47.826 0.00 0.00 41.02 3.67
571 587 3.657448 ATCCGATGGCGCACGTTCA 62.657 57.895 10.83 0.00 35.83 3.18
614 630 1.652187 ATGCCTGCCCCACATCTGAT 61.652 55.000 0.00 0.00 0.00 2.90
689 705 2.871096 AAAGTGGGGCAGATCGTAAA 57.129 45.000 0.00 0.00 0.00 2.01
935 952 1.063190 AGGAGGTCGACATATCACCCA 60.063 52.381 18.91 0.00 30.49 4.51
939 956 3.361786 TGACAAGGAGGTCGACATATCA 58.638 45.455 18.91 7.14 40.72 2.15
1213 1231 3.763360 TCGAAATGGTGGCATTTCTTCAT 59.237 39.130 5.61 0.00 44.83 2.57
1435 1453 6.207025 GCTATCAGATTGGATTGCTTCTTCAT 59.793 38.462 0.00 0.00 41.03 2.57
1728 1746 7.415318 GCTGCTCAAGTACTACTTACTGTCATA 60.415 40.741 0.00 0.00 40.44 2.15
1857 1876 1.068954 GCTTGTTTCTGGGCTTTCTCG 60.069 52.381 0.00 0.00 0.00 4.04
1889 1908 5.012893 AGAACCAAGCAATCCTTCCTAAAG 58.987 41.667 0.00 0.00 0.00 1.85
1951 1976 7.911130 TCCTCAATGAGATAGAAGAGATTGT 57.089 36.000 12.53 0.00 0.00 2.71
2343 2372 5.046448 TCCCAAGTTTAGACACGGCTAATTA 60.046 40.000 0.00 0.00 31.00 1.40
2405 2434 8.827677 CAACCCTATCTAAGTTAAGTTATGTGC 58.172 37.037 3.23 0.00 0.00 4.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.