Multiple sequence alignment - TraesCS2B01G164600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G164600 chr2B 100.000 2960 0 0 1 2960 136755560 136752601 0.000000e+00 5467.0
1 TraesCS2B01G164600 chr2B 98.903 2916 24 4 1 2915 201388422 201385514 0.000000e+00 5201.0
2 TraesCS2B01G164600 chr2B 88.483 356 37 3 20 372 259388783 259388429 7.580000e-116 427.0
3 TraesCS2B01G164600 chr2B 88.652 141 12 4 375 513 259372396 259372258 5.070000e-38 169.0
4 TraesCS2B01G164600 chr6B 96.343 2324 56 10 582 2885 131652249 131649935 0.000000e+00 3794.0
5 TraesCS2B01G164600 chr6B 97.094 585 12 2 1 584 131652875 131652295 0.000000e+00 981.0
6 TraesCS2B01G164600 chr6B 88.983 354 37 2 20 372 71577743 71578095 1.260000e-118 436.0
7 TraesCS2B01G164600 chr6B 86.327 373 28 11 2592 2960 71579190 71579543 4.630000e-103 385.0
8 TraesCS2B01G164600 chr6B 88.889 288 27 3 2454 2739 546998348 546998632 1.690000e-92 350.0
9 TraesCS2B01G164600 chr3A 96.712 1764 50 4 1197 2960 17712074 17713829 0.000000e+00 2929.0
10 TraesCS2B01G164600 chr5D 91.260 778 52 5 1466 2228 117343678 117342902 0.000000e+00 1046.0
11 TraesCS2B01G164600 chr5D 94.924 197 10 0 947 1143 117344913 117344717 2.870000e-80 309.0
12 TraesCS2B01G164600 chr5D 89.535 172 17 1 413 584 124112583 124112413 1.790000e-52 217.0
13 TraesCS2B01G164600 chr5D 97.015 67 2 0 1190 1256 117344425 117344359 2.410000e-21 113.0
14 TraesCS2B01G164600 chr5D 94.000 50 3 0 1139 1188 117344596 117344547 3.160000e-10 76.8
15 TraesCS2B01G164600 chr5B 97.133 593 10 3 2365 2957 273698194 273698779 0.000000e+00 994.0
16 TraesCS2B01G164600 chr5B 89.909 773 66 4 1466 2228 129526004 129526774 0.000000e+00 985.0
17 TraesCS2B01G164600 chr5B 87.921 356 37 4 1 355 79778484 79778834 5.900000e-112 414.0
18 TraesCS2B01G164600 chr5B 83.333 366 36 13 2597 2960 79781091 79781433 6.160000e-82 315.0
19 TraesCS2B01G164600 chr5B 90.909 77 7 0 1390 1466 129525801 129525877 1.450000e-18 104.0
20 TraesCS2B01G164600 chr5A 88.875 773 65 12 1466 2228 126302188 126301427 0.000000e+00 931.0
21 TraesCS2B01G164600 chr5A 94.924 197 10 0 947 1143 126303413 126303217 2.870000e-80 309.0
22 TraesCS2B01G164600 chr5A 97.015 67 2 0 1190 1256 126302934 126302868 2.410000e-21 113.0
23 TraesCS2B01G164600 chr3B 96.920 552 9 3 2365 2916 414832113 414831570 0.000000e+00 918.0
24 TraesCS2B01G164600 chr3B 87.887 355 39 2 1 355 792626465 792626815 5.900000e-112 414.0
25 TraesCS2B01G164600 chr4A 88.340 729 56 11 2236 2960 279475119 279474416 0.000000e+00 848.0
26 TraesCS2B01G164600 chr4A 92.027 439 28 4 146 584 279475950 279475519 7.010000e-171 610.0
27 TraesCS2B01G164600 chr4A 94.102 373 13 4 582 947 279475473 279475103 2.580000e-155 558.0
28 TraesCS2B01G164600 chr4A 87.887 355 38 3 1 355 593461131 593460782 2.120000e-111 412.0
29 TraesCS2B01G164600 chr4B 88.483 356 38 2 20 372 471110772 471111127 7.580000e-116 427.0
30 TraesCS2B01G164600 chr4D 91.111 270 21 1 2454 2723 490970677 490970943 2.170000e-96 363.0
31 TraesCS2B01G164600 chr4D 86.294 197 23 4 2767 2960 490970949 490971144 8.310000e-51 211.0
32 TraesCS2B01G164600 chr1D 91.111 270 21 1 2454 2723 256257167 256256901 2.170000e-96 363.0
33 TraesCS2B01G164600 chr7B 85.965 228 27 5 2228 2452 645112213 645112438 3.810000e-59 239.0
34 TraesCS2B01G164600 chr7B 83.575 207 21 6 2753 2956 645112834 645113030 6.520000e-42 182.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G164600 chr2B 136752601 136755560 2959 True 5467.0 5467 100.000000 1 2960 1 chr2B.!!$R1 2959
1 TraesCS2B01G164600 chr2B 201385514 201388422 2908 True 5201.0 5201 98.903000 1 2915 1 chr2B.!!$R2 2914
2 TraesCS2B01G164600 chr6B 131649935 131652875 2940 True 2387.5 3794 96.718500 1 2885 2 chr6B.!!$R1 2884
3 TraesCS2B01G164600 chr6B 71577743 71579543 1800 False 410.5 436 87.655000 20 2960 2 chr6B.!!$F2 2940
4 TraesCS2B01G164600 chr3A 17712074 17713829 1755 False 2929.0 2929 96.712000 1197 2960 1 chr3A.!!$F1 1763
5 TraesCS2B01G164600 chr5D 117342902 117344913 2011 True 386.2 1046 94.299750 947 2228 4 chr5D.!!$R2 1281
6 TraesCS2B01G164600 chr5B 273698194 273698779 585 False 994.0 994 97.133000 2365 2957 1 chr5B.!!$F1 592
7 TraesCS2B01G164600 chr5B 129525801 129526774 973 False 544.5 985 90.409000 1390 2228 2 chr5B.!!$F3 838
8 TraesCS2B01G164600 chr5B 79778484 79781433 2949 False 364.5 414 85.627000 1 2960 2 chr5B.!!$F2 2959
9 TraesCS2B01G164600 chr5A 126301427 126303413 1986 True 451.0 931 93.604667 947 2228 3 chr5A.!!$R1 1281
10 TraesCS2B01G164600 chr3B 414831570 414832113 543 True 918.0 918 96.920000 2365 2916 1 chr3B.!!$R1 551
11 TraesCS2B01G164600 chr4A 279474416 279475950 1534 True 672.0 848 91.489667 146 2960 3 chr4A.!!$R2 2814
12 TraesCS2B01G164600 chr7B 645112213 645113030 817 False 210.5 239 84.770000 2228 2956 2 chr7B.!!$F1 728

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
751 1401 0.520847 TGCATTGTGTGTGTATGCGG 59.479 50.000 0.0 0.0 45.80 5.69 F
1188 2629 1.671742 GGTCGTGGAGAAGGAGCAA 59.328 57.895 0.0 0.0 40.17 3.91 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1862 3908 1.213678 TGGCCATTGAAGCAGCTCTAT 59.786 47.619 0.0 0.0 0.0 1.98 R
2929 5176 2.155197 ATCCCAGCCCAACTTCCCAC 62.155 60.000 0.0 0.0 0.0 4.61 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
489 676 5.995446 ACAGGATTAGAAAGATCAACCCTC 58.005 41.667 0.0 0.0 0.00 4.30
751 1401 0.520847 TGCATTGTGTGTGTATGCGG 59.479 50.000 0.0 0.0 45.80 5.69
1188 2629 1.671742 GGTCGTGGAGAAGGAGCAA 59.328 57.895 0.0 0.0 40.17 3.91
1500 3414 5.106555 TGTGAAGAATTCCGATGAAAGCTTC 60.107 40.000 0.0 0.0 46.93 3.86
1765 3811 2.301296 CCAGCAGAGAAGAAGAGACCAA 59.699 50.000 0.0 0.0 0.00 3.67
2301 4359 6.370718 ACGCTAACTAATTTCAGGTTGTTAGG 59.629 38.462 0.0 0.0 38.02 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
489 676 6.455113 GCACAATGCTCTTGCTGAATATTTTG 60.455 38.462 0.00 0.00 40.96 2.44
751 1401 5.126384 TGATCAAATTTCGAATTGTACCCCC 59.874 40.000 10.44 0.00 0.00 5.40
1138 2331 4.373116 GTCGTCCTCCTTGCCGCA 62.373 66.667 0.00 0.00 0.00 5.69
1188 2629 6.380560 TCTCATCAGATTGATCAGACTTCTGT 59.619 38.462 18.53 9.51 44.12 3.41
1500 3414 0.250901 CCGGGCTATTGATGGGAAGG 60.251 60.000 0.00 0.00 0.00 3.46
1765 3811 1.302192 CATTCCACCCCGTGTTCGT 60.302 57.895 0.00 0.00 35.01 3.85
1862 3908 1.213678 TGGCCATTGAAGCAGCTCTAT 59.786 47.619 0.00 0.00 0.00 1.98
2301 4359 4.723248 CTTCCATAAACTCGTTTGAAGGC 58.277 43.478 5.35 0.00 31.74 4.35
2929 5176 2.155197 ATCCCAGCCCAACTTCCCAC 62.155 60.000 0.00 0.00 0.00 4.61


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.