Multiple sequence alignment - TraesCS2B01G155500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G155500 chr2B 100.000 2579 0 0 1 2579 123203591 123201013 0.000000e+00 4763
1 TraesCS2B01G155500 chr2B 95.404 1784 66 8 794 2570 801010452 801008678 0.000000e+00 2826
2 TraesCS2B01G155500 chr2B 98.290 1462 25 0 1118 2579 123292745 123291284 0.000000e+00 2562
3 TraesCS2B01G155500 chr2B 98.799 999 12 0 1 999 123302267 123301269 0.000000e+00 1779
4 TraesCS2B01G155500 chr2B 91.946 149 12 0 650 798 801010635 801010487 2.600000e-50 209
5 TraesCS2B01G155500 chr3A 96.600 2588 54 5 1 2579 605002569 605005131 0.000000e+00 4261
6 TraesCS2B01G155500 chr3A 92.941 1445 83 11 128 1555 145229269 145227827 0.000000e+00 2085
7 TraesCS2B01G155500 chr3A 93.182 132 9 0 1 132 145249805 145249674 7.280000e-46 195
8 TraesCS2B01G155500 chr5A 97.261 1935 50 2 648 2579 698130683 698132617 0.000000e+00 3277
9 TraesCS2B01G155500 chr5A 95.958 668 18 3 1 660 698129374 698130040 0.000000e+00 1075
10 TraesCS2B01G155500 chr6D 94.757 1793 84 4 794 2579 452315600 452313811 0.000000e+00 2782
11 TraesCS2B01G155500 chr6D 92.980 812 42 4 1 798 452316445 452315635 0.000000e+00 1170
12 TraesCS2B01G155500 chr2A 79.830 1760 339 14 828 2579 778793406 778795157 0.000000e+00 1269
13 TraesCS2B01G155500 chr3D 79.704 1759 341 16 826 2576 2883115 2884865 0.000000e+00 1256
14 TraesCS2B01G155500 chr7D 79.659 1760 339 19 825 2576 28220264 28222012 0.000000e+00 1249


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G155500 chr2B 123201013 123203591 2578 True 4763.0 4763 100.0000 1 2579 1 chr2B.!!$R1 2578
1 TraesCS2B01G155500 chr2B 123291284 123292745 1461 True 2562.0 2562 98.2900 1118 2579 1 chr2B.!!$R2 1461
2 TraesCS2B01G155500 chr2B 123301269 123302267 998 True 1779.0 1779 98.7990 1 999 1 chr2B.!!$R3 998
3 TraesCS2B01G155500 chr2B 801008678 801010635 1957 True 1517.5 2826 93.6750 650 2570 2 chr2B.!!$R4 1920
4 TraesCS2B01G155500 chr3A 605002569 605005131 2562 False 4261.0 4261 96.6000 1 2579 1 chr3A.!!$F1 2578
5 TraesCS2B01G155500 chr3A 145227827 145229269 1442 True 2085.0 2085 92.9410 128 1555 1 chr3A.!!$R1 1427
6 TraesCS2B01G155500 chr5A 698129374 698132617 3243 False 2176.0 3277 96.6095 1 2579 2 chr5A.!!$F1 2578
7 TraesCS2B01G155500 chr6D 452313811 452316445 2634 True 1976.0 2782 93.8685 1 2579 2 chr6D.!!$R1 2578
8 TraesCS2B01G155500 chr2A 778793406 778795157 1751 False 1269.0 1269 79.8300 828 2579 1 chr2A.!!$F1 1751
9 TraesCS2B01G155500 chr3D 2883115 2884865 1750 False 1256.0 1256 79.7040 826 2576 1 chr3D.!!$F1 1750
10 TraesCS2B01G155500 chr7D 28220264 28222012 1748 False 1249.0 1249 79.6590 825 2576 1 chr7D.!!$F1 1751

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
82 83 4.852697 AGGAAGGAAGAAGGTGAAGGTAAT 59.147 41.667 0.0 0.0 0.0 1.89 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1960 2694 4.856664 GGAAGATAGTCTTGCATTGCATG 58.143 43.478 12.95 14.85 43.23 4.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
82 83 4.852697 AGGAAGGAAGAAGGTGAAGGTAAT 59.147 41.667 0.00 0.00 0.00 1.89
457 480 8.324191 AGAGTTGAAGGAATCCATGAAGTATA 57.676 34.615 0.61 0.00 0.00 1.47
1472 2197 5.401531 AAGATTGACAGCATGAAAGCAAT 57.598 34.783 0.00 0.23 39.69 3.56
1576 2303 6.367969 GTGTGGTATGAAGAACGAATACACTT 59.632 38.462 0.00 0.00 33.78 3.16
1882 2610 2.104170 GTTGGAAGTGGTTTGTTGGGA 58.896 47.619 0.00 0.00 0.00 4.37
1960 2694 7.807977 TCAGATCAGCAAAAGGGATTAATAC 57.192 36.000 0.00 0.00 0.00 1.89
1961 2695 7.345691 TCAGATCAGCAAAAGGGATTAATACA 58.654 34.615 0.00 0.00 0.00 2.29
1962 2696 8.000709 TCAGATCAGCAAAAGGGATTAATACAT 58.999 33.333 0.00 0.00 0.00 2.29
1963 2697 8.080417 CAGATCAGCAAAAGGGATTAATACATG 58.920 37.037 0.00 0.00 0.00 3.21
1964 2698 6.147864 TCAGCAAAAGGGATTAATACATGC 57.852 37.500 0.00 4.68 0.00 4.06
1965 2699 5.655974 TCAGCAAAAGGGATTAATACATGCA 59.344 36.000 15.16 0.00 33.89 3.96
1988 2722 6.626623 GCAATGCAAGACTATCTTCCAAATGT 60.627 38.462 0.00 0.00 33.78 2.71
2059 2793 3.324268 ACATAGATCTCATGAGTGGCAGG 59.676 47.826 21.92 11.53 0.00 4.85
2192 2926 2.502577 GCATTGGGCAAGGGCATC 59.497 61.111 0.00 0.00 43.71 3.91
2440 3177 4.998671 TTGTTGAAGTGCTTTGGAATGA 57.001 36.364 0.00 0.00 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
82 83 1.305046 GAGGAGGAGTTCGGGGACA 60.305 63.158 0.00 0.00 0.00 4.02
1472 2197 5.105106 TCGGCAAACATATCTTGGAGAACTA 60.105 40.000 0.00 0.00 0.00 2.24
1576 2303 5.042463 TCCAACTGGTAATCAAACACTCA 57.958 39.130 0.00 0.00 36.34 3.41
1882 2610 9.228949 GTTGATATCCAGATCTTTGATAAGCAT 57.771 33.333 13.20 1.90 0.00 3.79
1960 2694 4.856664 GGAAGATAGTCTTGCATTGCATG 58.143 43.478 12.95 14.85 43.23 4.06
2125 2859 3.095332 CTCCATCAGGTGTCTCTTGAGA 58.905 50.000 0.00 0.00 35.68 3.27
2192 2926 5.048504 TCACAATTTGAGCCTAGCTGAAAAG 60.049 40.000 5.35 4.52 43.85 2.27
2416 3153 3.518634 TCCAAAGCACTTCAACAAACC 57.481 42.857 0.00 0.00 0.00 3.27
2440 3177 4.217118 GCTTCACTTCAAATCCATCTGTGT 59.783 41.667 0.00 0.00 0.00 3.72


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.