Multiple sequence alignment - TraesCS2B01G146900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G146900 chr2B 100.000 2366 0 0 1 2366 112869113 112866748 0 4370
1 TraesCS2B01G146900 chrUn 99.155 2367 18 2 1 2366 45100792 45098427 0 4259
2 TraesCS2B01G146900 chrUn 98.945 2369 21 4 1 2366 261513064 261515431 0 4233
3 TraesCS2B01G146900 chr5B 99.071 2368 19 3 1 2366 130614901 130612535 0 4248
4 TraesCS2B01G146900 chr5B 98.944 2368 21 4 1 2366 130609877 130607512 0 4231
5 TraesCS2B01G146900 chr5B 98.650 2371 27 3 1 2366 130568755 130571125 0 4196
6 TraesCS2B01G146900 chr3A 98.986 2367 23 1 1 2366 66030313 66032679 0 4237
7 TraesCS2B01G146900 chr7B 98.692 2370 27 3 1 2366 743033700 743036069 0 4202
8 TraesCS2B01G146900 chr2A 98.268 2367 34 2 1 2366 735223472 735225832 0 4137
9 TraesCS2B01G146900 chr5A 98.186 2371 37 4 1 2366 238861455 238859086 0 4135


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G146900 chr2B 112866748 112869113 2365 True 4370.0 4370 100.0000 1 2366 1 chr2B.!!$R1 2365
1 TraesCS2B01G146900 chrUn 45098427 45100792 2365 True 4259.0 4259 99.1550 1 2366 1 chrUn.!!$R1 2365
2 TraesCS2B01G146900 chrUn 261513064 261515431 2367 False 4233.0 4233 98.9450 1 2366 1 chrUn.!!$F1 2365
3 TraesCS2B01G146900 chr5B 130607512 130614901 7389 True 4239.5 4248 99.0075 1 2366 2 chr5B.!!$R1 2365
4 TraesCS2B01G146900 chr5B 130568755 130571125 2370 False 4196.0 4196 98.6500 1 2366 1 chr5B.!!$F1 2365
5 TraesCS2B01G146900 chr3A 66030313 66032679 2366 False 4237.0 4237 98.9860 1 2366 1 chr3A.!!$F1 2365
6 TraesCS2B01G146900 chr7B 743033700 743036069 2369 False 4202.0 4202 98.6920 1 2366 1 chr7B.!!$F1 2365
7 TraesCS2B01G146900 chr2A 735223472 735225832 2360 False 4137.0 4137 98.2680 1 2366 1 chr2A.!!$F1 2365
8 TraesCS2B01G146900 chr5A 238859086 238861455 2369 True 4135.0 4135 98.1860 1 2366 1 chr5A.!!$R1 2365

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
364 365 2.252855 GCGCGTAGGAGATCGAGG 59.747 66.667 8.43 0.0 0.0 4.63 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1617 1626 0.468648 GCTCCCTAACCTAATGCGGT 59.531 55.0 0.0 0.0 39.48 5.68 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
364 365 2.252855 GCGCGTAGGAGATCGAGG 59.747 66.667 8.43 0.0 0.00 4.63
445 446 7.885009 AGAGGGTCTCTACAAGTCTATAAAC 57.115 40.000 0.00 0.0 39.28 2.01
950 951 3.672511 GCTCGTCCGTGATAACTTCTTCA 60.673 47.826 0.00 0.0 0.00 3.02
1326 1333 3.696051 TCCAAGAAGAATTGTGCTATGCC 59.304 43.478 0.00 0.0 0.00 4.40
1774 1783 7.783042 AGAGGTACTAAATACAACTCCATGAC 58.217 38.462 0.00 0.0 41.55 3.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
12 13 2.158726 GGACACCTACCACTTTTCACCA 60.159 50.000 0.00 0.0 0.00 4.17
315 316 1.902432 CGGGAGACGGGGTCCTATC 60.902 68.421 0.64 0.0 39.42 2.08
445 446 4.881920 ACCGATCAATTTTTGGGAACTTG 58.118 39.130 0.00 0.0 0.00 3.16
950 951 1.067142 TCCGCTAGTTCACGCAAATCT 60.067 47.619 0.00 0.0 0.00 2.40
1339 1347 2.366916 AGGCAGCTCTTTCGCATATAGT 59.633 45.455 0.00 0.0 0.00 2.12
1345 1353 2.359107 CCAGGCAGCTCTTTCGCA 60.359 61.111 0.00 0.0 0.00 5.10
1415 1424 0.737219 CGTCGGTCGGTCCTAGAAAT 59.263 55.000 0.00 0.0 35.71 2.17
1617 1626 0.468648 GCTCCCTAACCTAATGCGGT 59.531 55.000 0.00 0.0 39.48 5.68
1774 1783 2.287788 ACGCAACCTTCATTTTGCTCAG 60.288 45.455 4.91 0.0 44.94 3.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.