Multiple sequence alignment - TraesCS2B01G136900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G136900 chr2B 100.000 2794 0 0 1 2794 104010482 104007689 0.000000e+00 5160.0
1 TraesCS2B01G136900 chr2B 95.312 64 2 1 1248 1310 394112514 394112577 1.770000e-17 100.0
2 TraesCS2B01G136900 chr5A 99.425 1566 8 1 1230 2794 571757682 571759247 0.000000e+00 2841.0
3 TraesCS2B01G136900 chr5A 97.900 1238 15 1 1 1238 571756412 571757638 0.000000e+00 2132.0
4 TraesCS2B01G136900 chr3D 92.779 637 31 7 2168 2794 604263819 604263188 0.000000e+00 907.0
5 TraesCS2B01G136900 chr3D 94.929 493 24 1 624 1116 604264738 604264247 0.000000e+00 771.0
6 TraesCS2B01G136900 chr3D 95.039 383 19 0 1791 2173 604264248 604263866 1.110000e-168 603.0
7 TraesCS2B01G136900 chr3D 96.078 51 2 0 1 51 565647822 565647772 1.780000e-12 84.2
8 TraesCS2B01G136900 chr5D 85.629 501 59 9 1596 2094 373209292 373209781 5.340000e-142 514.0
9 TraesCS2B01G136900 chr5D 89.785 186 17 1 1271 1456 63382290 63382473 1.290000e-58 237.0
10 TraesCS2B01G136900 chr5D 87.831 189 19 3 738 924 63381880 63382066 4.690000e-53 219.0
11 TraesCS2B01G136900 chr5D 89.080 174 19 0 975 1148 63382066 63382239 1.690000e-52 217.0
12 TraesCS2B01G136900 chr5D 80.323 310 24 15 1455 1755 373207504 373207785 1.700000e-47 200.0
13 TraesCS2B01G136900 chr5D 94.643 112 5 1 1457 1567 373209180 373209291 3.700000e-39 172.0
14 TraesCS2B01G136900 chr5B 85.429 501 60 9 1596 2094 443274504 443274993 2.480000e-140 508.0
15 TraesCS2B01G136900 chr5B 80.645 310 23 16 1455 1755 443272716 443272997 3.650000e-49 206.0
16 TraesCS2B01G136900 chr5B 94.643 112 5 1 1457 1567 443274392 443274503 3.700000e-39 172.0
17 TraesCS2B01G136900 chr5B 84.444 180 18 5 2168 2347 608406758 608406589 4.790000e-38 169.0
18 TraesCS2B01G136900 chr7D 89.717 389 27 4 2351 2727 82931427 82931040 4.180000e-133 484.0
19 TraesCS2B01G136900 chr7D 96.078 51 2 0 1 51 519400818 519400768 1.780000e-12 84.2
20 TraesCS2B01G136900 chrUn 96.244 213 8 0 266 478 49289400 49289188 1.590000e-92 350.0
21 TraesCS2B01G136900 chrUn 96.244 213 8 0 266 478 297363393 297363181 1.590000e-92 350.0
22 TraesCS2B01G136900 chrUn 96.244 213 8 0 266 478 364571634 364571846 1.590000e-92 350.0
23 TraesCS2B01G136900 chrUn 96.244 213 8 0 266 478 447563886 447564098 1.590000e-92 350.0
24 TraesCS2B01G136900 chrUn 96.078 153 4 1 477 629 49289132 49288982 5.980000e-62 248.0
25 TraesCS2B01G136900 chrUn 96.078 153 4 1 477 629 297363125 297362975 5.980000e-62 248.0
26 TraesCS2B01G136900 chrUn 96.078 153 4 1 477 629 364571902 364572052 5.980000e-62 248.0
27 TraesCS2B01G136900 chrUn 96.078 153 4 1 477 629 447564154 447564304 5.980000e-62 248.0
28 TraesCS2B01G136900 chrUn 94.771 153 6 1 477 629 958414 958564 1.290000e-58 237.0
29 TraesCS2B01G136900 chrUn 94.771 153 6 1 477 629 373656063 373656213 1.290000e-58 237.0
30 TraesCS2B01G136900 chrUn 95.833 48 2 0 98 145 957949 957996 8.300000e-11 78.7
31 TraesCS2B01G136900 chrUn 92.727 55 2 2 98 152 49289598 49289546 8.300000e-11 78.7
32 TraesCS2B01G136900 chrUn 92.727 55 2 2 98 152 297363591 297363539 8.300000e-11 78.7
33 TraesCS2B01G136900 chrUn 95.833 48 2 0 98 145 364571436 364571483 8.300000e-11 78.7
34 TraesCS2B01G136900 chrUn 95.833 48 2 0 98 145 373655598 373655645 8.300000e-11 78.7
35 TraesCS2B01G136900 chrUn 95.833 48 2 0 98 145 447563688 447563735 8.300000e-11 78.7
36 TraesCS2B01G136900 chr7B 96.262 214 7 1 266 478 589683779 589683992 1.590000e-92 350.0
37 TraesCS2B01G136900 chr7B 95.425 153 5 1 477 629 589684048 589684198 2.780000e-60 243.0
38 TraesCS2B01G136900 chr7B 94.737 38 1 1 1 37 261953209 261953246 1.080000e-04 58.4
39 TraesCS2B01G136900 chr1B 95.794 214 8 1 266 478 130547659 130547872 7.410000e-91 344.0
40 TraesCS2B01G136900 chr1B 95.327 214 9 1 266 478 211994342 211994129 3.450000e-89 339.0
41 TraesCS2B01G136900 chr4A 95.714 210 9 0 269 478 700676265 700676056 3.450000e-89 339.0
42 TraesCS2B01G136900 chr4D 89.785 186 19 0 1271 1456 143315093 143314908 3.600000e-59 239.0
43 TraesCS2B01G136900 chr4D 89.080 174 19 0 975 1148 143315317 143315144 1.690000e-52 217.0
44 TraesCS2B01G136900 chr3A 94.771 153 6 1 477 629 614765674 614765524 1.290000e-58 237.0
45 TraesCS2B01G136900 chr6A 82.051 195 24 6 2168 2361 245129905 245129721 3.730000e-34 156.0
46 TraesCS2B01G136900 chr2A 89.091 110 12 0 1346 1455 393015019 393014910 1.350000e-28 137.0
47 TraesCS2B01G136900 chr7A 96.078 51 2 0 1 51 55372855 55372805 1.780000e-12 84.2
48 TraesCS2B01G136900 chr1A 96.078 51 2 0 1 51 538135948 538135998 1.780000e-12 84.2
49 TraesCS2B01G136900 chr1A 95.833 48 2 0 98 145 517843365 517843412 8.300000e-11 78.7
50 TraesCS2B01G136900 chr1A 95.833 48 2 0 98 145 517863114 517863161 8.300000e-11 78.7
51 TraesCS2B01G136900 chr3B 94.118 51 3 0 1 51 736413519 736413569 8.300000e-11 78.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G136900 chr2B 104007689 104010482 2793 True 5160.000000 5160 100.000000 1 2794 1 chr2B.!!$R1 2793
1 TraesCS2B01G136900 chr5A 571756412 571759247 2835 False 2486.500000 2841 98.662500 1 2794 2 chr5A.!!$F1 2793
2 TraesCS2B01G136900 chr3D 604263188 604264738 1550 True 760.333333 907 94.249000 624 2794 3 chr3D.!!$R2 2170
3 TraesCS2B01G136900 chr5D 373207504 373209781 2277 False 295.333333 514 86.865000 1455 2094 3 chr5D.!!$F2 639
4 TraesCS2B01G136900 chr5D 63381880 63382473 593 False 224.333333 237 88.898667 738 1456 3 chr5D.!!$F1 718
5 TraesCS2B01G136900 chr5B 443272716 443274993 2277 False 295.333333 508 86.905667 1455 2094 3 chr5B.!!$F1 639
6 TraesCS2B01G136900 chrUn 49288982 49289598 616 True 225.566667 350 95.016333 98 629 3 chrUn.!!$R1 531
7 TraesCS2B01G136900 chrUn 297362975 297363591 616 True 225.566667 350 95.016333 98 629 3 chrUn.!!$R2 531
8 TraesCS2B01G136900 chrUn 364571436 364572052 616 False 225.566667 350 96.051667 98 629 3 chrUn.!!$F2 531
9 TraesCS2B01G136900 chrUn 447563688 447564304 616 False 225.566667 350 96.051667 98 629 3 chrUn.!!$F4 531

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
956 1086 0.732571 CATGCGTTGGTGATGGGTAC 59.267 55.0 0.0 0.0 0.0 3.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2381 4290 4.5739 AGAAGATGCTTTGTTCTCGATGT 58.426 39.13 0.0 0.0 0.0 3.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
174 245 8.827832 ACATCAGAAATCAATCCAATTTAGGA 57.172 30.769 0.00 0.00 43.01 2.94
950 1080 1.882912 ATATCGCATGCGTTGGTGAT 58.117 45.000 36.50 24.27 40.74 3.06
956 1086 0.732571 CATGCGTTGGTGATGGGTAC 59.267 55.000 0.00 0.00 0.00 3.34
1116 1246 2.362736 AGCGATGCACTGATCATGTTT 58.637 42.857 0.00 0.00 0.00 2.83
1240 1370 8.686194 CATTACACCTATAAATGATCGGCACGT 61.686 40.741 0.00 0.00 41.87 4.49
1810 3667 5.360714 TCAATTAGATTGGACAATGGCTTCC 59.639 40.000 1.69 0.00 40.61 3.46
2719 4639 5.940470 TGAGGTTCTCAGCCTTCTTAAATTC 59.060 40.000 0.00 0.00 35.39 2.17
2758 4678 4.620184 GCATTTTCAAAGCAGACATGAGTC 59.380 41.667 0.00 0.00 45.31 3.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
44 45 5.048083 TCTGACCCTGTGATTTTGTTATTGC 60.048 40.000 0.00 0.00 0.00 3.56
685 813 7.540299 ACAAAGAACGAAATAACCAAACTGAA 58.460 30.769 0.00 0.00 0.00 3.02
950 1080 1.878948 GCCTGCAAACTTACGTACCCA 60.879 52.381 0.00 0.00 0.00 4.51
956 1086 0.163788 CACTCGCCTGCAAACTTACG 59.836 55.000 0.00 0.00 0.00 3.18
1116 1246 4.354155 GCACAACGCTGTACCTGA 57.646 55.556 0.00 0.00 37.77 3.86
1176 1306 4.080807 ACATGGTAAACCGATCATGTACCA 60.081 41.667 15.31 15.31 45.49 3.25
1240 1370 5.338381 GGGATCAGAGGTCAAAAGTACATGA 60.338 44.000 0.00 0.00 0.00 3.07
1241 1371 4.878397 GGGATCAGAGGTCAAAAGTACATG 59.122 45.833 0.00 0.00 0.00 3.21
2102 3959 8.765488 ATCAACTCGGAGATATGATGATAGAT 57.235 34.615 12.86 0.00 39.28 1.98
2381 4290 4.573900 AGAAGATGCTTTGTTCTCGATGT 58.426 39.130 0.00 0.00 0.00 3.06
2719 4639 6.085573 TGAAAATGCACACAACATAGAATCG 58.914 36.000 0.00 0.00 0.00 3.34
2758 4678 5.418840 AGGCATGGTAAACACAAAGGATAAG 59.581 40.000 0.00 0.00 0.00 1.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.