Multiple sequence alignment - TraesCS2B01G134000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G134000 chr2B 100.000 4430 0 0 1 4430 100093709 100089280 0.000000e+00 8181.0
1 TraesCS2B01G134000 chr2B 92.747 1365 89 6 433 1795 392029279 392030635 0.000000e+00 1964.0
2 TraesCS2B01G134000 chr2B 90.314 1084 85 8 1949 3023 392030684 392031756 0.000000e+00 1402.0
3 TraesCS2B01G134000 chr2B 92.523 428 31 1 1 427 392028212 392028639 2.930000e-171 612.0
4 TraesCS2B01G134000 chr2B 91.633 251 21 0 1796 2046 392030477 392030727 9.120000e-92 348.0
5 TraesCS2B01G134000 chr2B 100.000 44 0 0 3738 3781 100089903 100089860 1.020000e-11 82.4
6 TraesCS2B01G134000 chr2B 100.000 44 0 0 3807 3850 100089972 100089929 1.020000e-11 82.4
7 TraesCS2B01G134000 chr5A 96.708 2187 68 2 940 3124 470941655 470943839 0.000000e+00 3637.0
8 TraesCS2B01G134000 chr5A 97.066 1227 27 3 3207 4430 470943841 470945061 0.000000e+00 2058.0
9 TraesCS2B01G134000 chr5A 93.478 460 30 0 1587 2046 3909851 3909392 0.000000e+00 684.0
10 TraesCS2B01G134000 chr5A 92.955 440 27 2 503 941 470941088 470941524 4.830000e-179 638.0
11 TraesCS2B01G134000 chr5A 97.126 348 9 1 4074 4420 3895763 3895416 1.780000e-163 586.0
12 TraesCS2B01G134000 chr5A 97.872 47 1 0 3735 3781 470944432 470944478 1.020000e-11 82.4
13 TraesCS2B01G134000 chr5A 100.000 33 0 0 3818 3850 470944377 470944409 1.330000e-05 62.1
14 TraesCS2B01G134000 chr3A 96.527 2188 71 3 940 3124 662573606 662571421 0.000000e+00 3615.0
15 TraesCS2B01G134000 chr3A 97.229 1227 29 2 3207 4430 662571419 662570195 0.000000e+00 2073.0
16 TraesCS2B01G134000 chr3A 92.727 440 28 2 503 941 662574174 662573738 2.250000e-177 632.0
17 TraesCS2B01G134000 chr3A 91.829 257 15 5 174 428 25054037 25054289 1.960000e-93 353.0
18 TraesCS2B01G134000 chr3A 100.000 44 0 0 3738 3781 662570821 662570778 1.020000e-11 82.4
19 TraesCS2B01G134000 chr3A 100.000 44 0 0 3807 3850 662570890 662570847 1.020000e-11 82.4
20 TraesCS2B01G134000 chr5D 92.846 2013 122 5 994 2997 127930672 127928673 0.000000e+00 2900.0
21 TraesCS2B01G134000 chr5D 93.182 528 23 3 427 953 127931301 127930786 0.000000e+00 763.0
22 TraesCS2B01G134000 chr5D 93.931 379 20 2 3364 3741 510560153 510560529 1.790000e-158 569.0
23 TraesCS2B01G134000 chr5D 95.265 359 14 3 4074 4430 127927368 127927011 2.310000e-157 566.0
24 TraesCS2B01G134000 chr5D 91.228 342 21 4 3033 3366 510559771 510560111 1.450000e-124 457.0
25 TraesCS2B01G134000 chr5D 90.643 342 23 4 3033 3366 445019018 445018678 3.140000e-121 446.0
26 TraesCS2B01G134000 chr5D 87.970 266 22 6 170 427 320323942 320324205 5.570000e-79 305.0
27 TraesCS2B01G134000 chr1D 92.747 2013 123 6 994 2997 415604968 415606966 0.000000e+00 2887.0
28 TraesCS2B01G134000 chr1D 95.265 359 14 3 4074 4430 415608272 415608629 2.310000e-157 566.0
29 TraesCS2B01G134000 chr1D 96.923 65 2 0 889 953 415604790 415604854 4.680000e-20 110.0
30 TraesCS2B01G134000 chr6D 92.673 2020 118 10 994 2997 450179895 450177890 0.000000e+00 2883.0
31 TraesCS2B01G134000 chr6D 95.543 359 13 3 4074 4430 450176584 450176227 4.970000e-159 571.0
32 TraesCS2B01G134000 chr6D 95.455 330 15 0 624 953 450180338 450180009 1.090000e-145 527.0
33 TraesCS2B01G134000 chr6D 86.628 172 10 3 427 597 450180479 450180320 1.270000e-40 178.0
34 TraesCS2B01G134000 chr7D 92.499 2013 129 5 994 2997 340191324 340193323 0.000000e+00 2861.0
35 TraesCS2B01G134000 chr7D 94.348 1610 79 5 438 2046 449486406 449484808 0.000000e+00 2459.0
36 TraesCS2B01G134000 chr7D 90.884 1086 79 8 1949 3023 449484851 449483775 0.000000e+00 1439.0
37 TraesCS2B01G134000 chr7D 93.182 528 23 3 427 953 340190695 340191210 0.000000e+00 763.0
38 TraesCS2B01G134000 chr7D 94.986 359 15 3 4074 4430 340194628 340194985 1.080000e-155 560.0
39 TraesCS2B01G134000 chr7D 94.163 257 13 2 174 428 600498418 600498674 1.490000e-104 390.0
40 TraesCS2B01G134000 chr7D 91.489 235 18 2 194 427 7603853 7604086 5.530000e-84 322.0
41 TraesCS2B01G134000 chr7D 94.798 173 9 0 1 173 449486915 449486743 2.030000e-68 270.0
42 TraesCS2B01G134000 chr7B 94.843 1629 79 4 1964 3590 593329040 593327415 0.000000e+00 2538.0
43 TraesCS2B01G134000 chr7B 93.997 633 37 1 940 1572 593330163 593329532 0.000000e+00 957.0
44 TraesCS2B01G134000 chr7B 96.919 357 11 0 4074 4430 593326864 593326508 2.280000e-167 599.0
45 TraesCS2B01G134000 chr7B 95.686 255 10 1 174 427 719160906 719160652 4.120000e-110 409.0
46 TraesCS2B01G134000 chr7B 87.079 356 40 4 465 818 593339667 593339316 8.930000e-107 398.0
47 TraesCS2B01G134000 chr7B 97.714 175 4 0 3656 3830 593327416 593327242 7.200000e-78 302.0
48 TraesCS2B01G134000 chr7B 89.062 128 14 0 814 941 593330422 593330295 4.590000e-35 159.0
49 TraesCS2B01G134000 chr7B 93.421 76 3 2 3929 4003 593327244 593327170 1.300000e-20 111.0
50 TraesCS2B01G134000 chr7B 100.000 44 0 0 3807 3850 593327334 593327291 1.020000e-11 82.4
51 TraesCS2B01G134000 chr1B 90.404 990 78 9 2760 3741 289695736 289696716 0.000000e+00 1286.0
52 TraesCS2B01G134000 chr1B 89.736 341 24 6 3035 3366 680992291 680992629 4.100000e-115 425.0
53 TraesCS2B01G134000 chr3B 86.752 1019 71 28 2754 3741 775656712 775655727 0.000000e+00 1075.0
54 TraesCS2B01G134000 chr3B 94.902 255 11 2 174 427 66600758 66601011 8.930000e-107 398.0
55 TraesCS2B01G134000 chr7A 92.991 428 23 5 3315 3741 41462592 41462171 6.300000e-173 617.0
56 TraesCS2B01G134000 chr7A 92.740 427 25 3 3315 3741 617600706 617601126 2.930000e-171 612.0
57 TraesCS2B01G134000 chr7A 90.671 343 21 6 3033 3366 576789566 576789226 3.140000e-121 446.0
58 TraesCS2B01G134000 chr7A 90.087 343 23 6 3033 3366 658275468 658275808 6.800000e-118 435.0
59 TraesCS2B01G134000 chr7A 81.991 422 42 14 547 941 28894225 28893811 1.190000e-85 327.0
60 TraesCS2B01G134000 chr7A 81.754 422 43 14 547 941 28865324 28864910 5.530000e-84 322.0
61 TraesCS2B01G134000 chr7A 91.111 90 8 0 37 126 28989239 28989150 6.020000e-24 122.0
62 TraesCS2B01G134000 chr7A 89.362 94 9 1 37 130 28825520 28825428 2.800000e-22 117.0
63 TraesCS2B01G134000 chr2A 92.523 428 25 4 3315 3741 756526673 756527094 1.360000e-169 606.0
64 TraesCS2B01G134000 chr2A 89.504 343 25 6 3033 3366 764886287 764886627 1.470000e-114 424.0
65 TraesCS2B01G134000 chr4B 91.120 259 23 0 4171 4429 3319516 3319258 7.050000e-93 351.0
66 TraesCS2B01G134000 chr6B 87.687 268 23 6 168 427 22247478 22247743 2.000000e-78 303.0
67 TraesCS2B01G134000 chrUn 87.594 266 23 6 170 427 348381773 348382036 2.590000e-77 300.0
68 TraesCS2B01G134000 chrUn 90.000 90 9 0 37 126 324331261 324331350 2.800000e-22 117.0
69 TraesCS2B01G134000 chrUn 90.000 90 9 0 37 126 324334415 324334504 2.800000e-22 117.0
70 TraesCS2B01G134000 chrUn 90.000 90 9 0 37 126 340811440 340811351 2.800000e-22 117.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G134000 chr2B 100089280 100093709 4429 True 2781.933333 8181 100.000000 1 4430 3 chr2B.!!$R1 4429
1 TraesCS2B01G134000 chr2B 392028212 392031756 3544 False 1081.500000 1964 91.804250 1 3023 4 chr2B.!!$F1 3022
2 TraesCS2B01G134000 chr5A 470941088 470945061 3973 False 1295.500000 3637 96.920200 503 4430 5 chr5A.!!$F1 3927
3 TraesCS2B01G134000 chr3A 662570195 662574174 3979 True 1296.960000 3615 97.296600 503 4430 5 chr3A.!!$R1 3927
4 TraesCS2B01G134000 chr5D 127927011 127931301 4290 True 1409.666667 2900 93.764333 427 4430 3 chr5D.!!$R2 4003
5 TraesCS2B01G134000 chr5D 510559771 510560529 758 False 513.000000 569 92.579500 3033 3741 2 chr5D.!!$F2 708
6 TraesCS2B01G134000 chr1D 415604790 415608629 3839 False 1187.666667 2887 94.978333 889 4430 3 chr1D.!!$F1 3541
7 TraesCS2B01G134000 chr6D 450176227 450180479 4252 True 1039.750000 2883 92.574750 427 4430 4 chr6D.!!$R1 4003
8 TraesCS2B01G134000 chr7D 340190695 340194985 4290 False 1394.666667 2861 93.555667 427 4430 3 chr7D.!!$F3 4003
9 TraesCS2B01G134000 chr7D 449483775 449486915 3140 True 1389.333333 2459 93.343333 1 3023 3 chr7D.!!$R1 3022
10 TraesCS2B01G134000 chr7B 593326508 593330422 3914 True 678.342857 2538 95.136571 814 4430 7 chr7B.!!$R3 3616
11 TraesCS2B01G134000 chr1B 289695736 289696716 980 False 1286.000000 1286 90.404000 2760 3741 1 chr1B.!!$F1 981
12 TraesCS2B01G134000 chr3B 775655727 775656712 985 True 1075.000000 1075 86.752000 2754 3741 1 chr3B.!!$R1 987


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
387 389 1.073216 CTAGCACTTCAGGTGTCGCG 61.073 60.000 0.00 0.0 46.86 5.87 F
431 1067 2.222508 GGAATGTGACGACGACGATTTG 60.223 50.000 15.32 0.0 42.66 2.32 F
819 1483 3.453353 TGTTTCCCTCCCTCTTATTACCG 59.547 47.826 0.00 0.0 0.00 4.02 F
1134 2004 3.640029 GGATCATGGATTCAAAGGCACAT 59.360 43.478 0.00 0.0 0.00 3.21 F
2374 3477 1.281577 TGTTAGGCCAGCATGATGTCA 59.718 47.619 10.55 0.0 39.69 3.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1307 2177 0.106868 CCTCTGATCCATGGCTGCAA 60.107 55.000 6.96 0.0 0.00 4.08 R
1497 2367 0.399454 CCATGCGGATCTCCTCCATT 59.601 55.000 0.00 0.0 45.24 3.16 R
1787 2664 0.747283 GCCTTGTCATCCTGCTGAGG 60.747 60.000 0.00 0.0 41.39 3.86 R
2699 3802 1.221293 GAGGCTCATCACAGCTGCT 59.779 57.895 15.27 0.0 39.58 4.24 R
4014 5666 0.995024 CTGGGAGGTCCTTTGTCCAT 59.005 55.000 0.00 0.0 36.20 3.41 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)



Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.