AutoCloner

Multiple sequence alignment - TraesCS2B01G130100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS2B01G130100	chr2B	100.000	2742	0	0	1	2742	97423432	97426173	0.000000e+00	5064.0
1	TraesCS2B01G130100	chr2B	87.594	1201	94	31	943	2104	97414676	97415860	0.000000e+00	1341.0
2	TraesCS2B01G130100	chr2B	92.453	53	3	1	2145	2196	197590575	197590523	1.050000e-09	75.0
3	TraesCS2B01G130100	chr7D	93.018	888	54	6	61	945	10101076	10101958	0.000000e+00	1290.0
4	TraesCS2B01G130100	chr7D	90.719	862	59	12	61	918	629660846	629661690	0.000000e+00	1129.0
5	TraesCS2B01G130100	chr7D	89.078	879	79	9	61	936	503924723	503923859	0.000000e+00	1075.0
6	TraesCS2B01G130100	chr7D	88.843	484	48	5	473	952	4428757	4428276	8.460000e-165	590.0
7	TraesCS2B01G130100	chr2D	86.422	1090	83	35	944	1993	62052129	62053193	0.000000e+00	1133.0
8	TraesCS2B01G130100	chr2D	89.433	899	52	13	62	941	7239544	7240418	0.000000e+00	1094.0
9	TraesCS2B01G130100	chr2D	90.741	54	4	1	2143	2196	384489625	384489677	1.360000e-08	71.3
10	TraesCS2B01G130100	chr2D	90.566	53	3	2	2143	2194	248186023	248186074	4.900000e-08	69.4
11	TraesCS2B01G130100	chr2D	91.837	49	3	1	2149	2197	248579756	248579709	1.760000e-07	67.6
12	TraesCS2B01G130100	chr2A	92.793	777	49	5	944	1720	62380509	62381278	0.000000e+00	1118.0
13	TraesCS2B01G130100	chr2A	87.363	910	82	12	61	942	678532290	678533194	0.000000e+00	1013.0
14	TraesCS2B01G130100	chr2A	86.800	500	48	10	1653	2139	62381504	62381998	2.400000e-150	542.0
15	TraesCS2B01G130100	chr5D	89.907	862	67	11	61	917	565842145	565841299	0.000000e+00	1092.0
16	TraesCS2B01G130100	chr5D	88.354	893	71	15	61	936	435155486	435154610	0.000000e+00	1042.0
17	TraesCS2B01G130100	chr5D	93.092	304	17	3	61	363	379246159	379246459	2.510000e-120	442.0
18	TraesCS2B01G130100	chr1D	88.813	876	66	13	61	918	22593515	22594376	0.000000e+00	1046.0
19	TraesCS2B01G130100	chr1D	94.276	594	25	8	2155	2742	26415526	26416116	0.000000e+00	900.0
20	TraesCS2B01G130100	chr1D	91.332	473	28	4	61	532	476788389	476788849	3.850000e-178	634.0
21	TraesCS2B01G130100	chr3D	88.137	902	73	14	61	943	70094855	70093969	0.000000e+00	1042.0
22	TraesCS2B01G130100	chr3D	89.542	698	52	12	226	918	590029517	590028836	0.000000e+00	865.0
23	TraesCS2B01G130100	chr3A	87.569	901	78	13	61	942	699109644	699108759	0.000000e+00	1013.0
24	TraesCS2B01G130100	chr7A	86.780	885	90	17	61	942	695379801	695378941	0.000000e+00	961.0
25	TraesCS2B01G130100	chr5A	88.727	754	57	6	216	942	48885137	48885889	0.000000e+00	896.0
26	TraesCS2B01G130100	chr5A	93.878	49	2	1	2149	2197	297079401	297079448	3.790000e-09	73.1
27	TraesCS2B01G130100	chr6D	94.708	548	24	3	2166	2711	38451029	38450485	0.000000e+00	846.0
28	TraesCS2B01G130100	chr6D	94.526	548	25	4	2166	2711	38437785	38437241	0.000000e+00	841.0
29	TraesCS2B01G130100	chr5B	83.165	695	82	18	61	739	557256269	557255594	1.090000e-168	603.0
30	TraesCS2B01G130100	chr4A	88.172	465	47	5	480	937	626920489	626920026	5.160000e-152	547.0
31	TraesCS2B01G130100	chr1A	87.931	58	5	2	2143	2199	297095424	297095480	1.760000e-07	67.6

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS2B01G130100	chr2B	97423432	97426173	2741	False	5064	5064	100.0000	1	2742	1	chr2B.!!$F2	2741
1	TraesCS2B01G130100	chr2B	97414676	97415860	1184	False	1341	1341	87.5940	943	2104	1	chr2B.!!$F1	1161
2	TraesCS2B01G130100	chr7D	10101076	10101958	882	False	1290	1290	93.0180	61	945	1	chr7D.!!$F1	884
3	TraesCS2B01G130100	chr7D	629660846	629661690	844	False	1129	1129	90.7190	61	918	1	chr7D.!!$F2	857
4	TraesCS2B01G130100	chr7D	503923859	503924723	864	True	1075	1075	89.0780	61	936	1	chr7D.!!$R2	875
5	TraesCS2B01G130100	chr2D	62052129	62053193	1064	False	1133	1133	86.4220	944	1993	1	chr2D.!!$F2	1049
6	TraesCS2B01G130100	chr2D	7239544	7240418	874	False	1094	1094	89.4330	62	941	1	chr2D.!!$F1	879
7	TraesCS2B01G130100	chr2A	678532290	678533194	904	False	1013	1013	87.3630	61	942	1	chr2A.!!$F1	881
8	TraesCS2B01G130100	chr2A	62380509	62381998	1489	False	830	1118	89.7965	944	2139	2	chr2A.!!$F2	1195
9	TraesCS2B01G130100	chr5D	565841299	565842145	846	True	1092	1092	89.9070	61	917	1	chr5D.!!$R2	856
10	TraesCS2B01G130100	chr5D	435154610	435155486	876	True	1042	1042	88.3540	61	936	1	chr5D.!!$R1	875
11	TraesCS2B01G130100	chr1D	22593515	22594376	861	False	1046	1046	88.8130	61	918	1	chr1D.!!$F1	857
12	TraesCS2B01G130100	chr1D	26415526	26416116	590	False	900	900	94.2760	2155	2742	1	chr1D.!!$F2	587
13	TraesCS2B01G130100	chr3D	70093969	70094855	886	True	1042	1042	88.1370	61	943	1	chr3D.!!$R1	882
14	TraesCS2B01G130100	chr3D	590028836	590029517	681	True	865	865	89.5420	226	918	1	chr3D.!!$R2	692
15	TraesCS2B01G130100	chr3A	699108759	699109644	885	True	1013	1013	87.5690	61	942	1	chr3A.!!$R1	881
16	TraesCS2B01G130100	chr7A	695378941	695379801	860	True	961	961	86.7800	61	942	1	chr7A.!!$R1	881
17	TraesCS2B01G130100	chr5A	48885137	48885889	752	False	896	896	88.7270	216	942	1	chr5A.!!$F1	726
18	TraesCS2B01G130100	chr6D	38450485	38451029	544	True	846	846	94.7080	2166	2711	1	chr6D.!!$R2	545
19	TraesCS2B01G130100	chr6D	38437241	38437785	544	True	841	841	94.5260	2166	2711	1	chr6D.!!$R1	545
20	TraesCS2B01G130100	chr5B	557255594	557256269	675	True	603	603	83.1650	61	739	1	chr5B.!!$R1	678

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
769	885	0.468226	GATAACTGATGGGTCCCGCA	59.532	55.0	2.65	3.14	0.0	5.69	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
1862	2348	0.111061	TGGCCTCTTTGATGTGCACT	59.889	50.0	19.41	3.19	0.0	4.4	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
27	28	8.937634	AATGATTTTTGAGGCTTTCATACATC	57.062	30.769	0.00	0.00	35.27	3.06
28	29	6.866480	TGATTTTTGAGGCTTTCATACATCC	58.134	36.000	0.00	0.00	35.27	3.51
29	30	5.659440	TTTTTGAGGCTTTCATACATCCC	57.341	39.130	0.00	0.00	35.27	3.85
30	31	3.297134	TTGAGGCTTTCATACATCCCC	57.703	47.619	0.00	0.00	35.27	4.81
31	32	2.204463	TGAGGCTTTCATACATCCCCA	58.796	47.619	0.00	0.00	0.00	4.96
32	33	2.785269	TGAGGCTTTCATACATCCCCAT	59.215	45.455	0.00	0.00	0.00	4.00
33	34	3.205056	TGAGGCTTTCATACATCCCCATT	59.795	43.478	0.00	0.00	0.00	3.16
34	35	4.218312	GAGGCTTTCATACATCCCCATTT	58.782	43.478	0.00	0.00	0.00	2.32
35	36	4.623863	AGGCTTTCATACATCCCCATTTT	58.376	39.130	0.00	0.00	0.00	1.82
36	37	5.032170	AGGCTTTCATACATCCCCATTTTT	58.968	37.500	0.00	0.00	0.00	1.94
37	38	6.201591	AGGCTTTCATACATCCCCATTTTTA	58.798	36.000	0.00	0.00	0.00	1.52
38	39	6.845975	AGGCTTTCATACATCCCCATTTTTAT	59.154	34.615	0.00	0.00	0.00	1.40
39	40	6.930722	GGCTTTCATACATCCCCATTTTTATG	59.069	38.462	0.00	0.00	0.00	1.90
40	41	6.424812	GCTTTCATACATCCCCATTTTTATGC	59.575	38.462	0.00	0.00	0.00	3.14
41	42	7.429374	TTTCATACATCCCCATTTTTATGCA	57.571	32.000	0.00	0.00	0.00	3.96
42	43	7.615039	TTCATACATCCCCATTTTTATGCAT	57.385	32.000	3.79	3.79	0.00	3.96
43	44	6.995364	TCATACATCCCCATTTTTATGCATG	58.005	36.000	10.16	0.00	0.00	4.06
44	45	6.781507	TCATACATCCCCATTTTTATGCATGA	59.218	34.615	10.16	0.00	32.37	3.07
45	46	5.954153	ACATCCCCATTTTTATGCATGAA	57.046	34.783	10.16	4.23	0.00	2.57
46	47	5.673514	ACATCCCCATTTTTATGCATGAAC	58.326	37.500	10.16	0.00	0.00	3.18
47	48	5.426185	ACATCCCCATTTTTATGCATGAACT	59.574	36.000	10.16	0.00	0.00	3.01
48	49	6.070078	ACATCCCCATTTTTATGCATGAACTT	60.070	34.615	10.16	0.00	0.00	2.66
49	50	6.371595	TCCCCATTTTTATGCATGAACTTT	57.628	33.333	10.16	0.00	0.00	2.66
50	51	6.777782	TCCCCATTTTTATGCATGAACTTTT	58.222	32.000	10.16	0.00	0.00	2.27
51	52	6.878389	TCCCCATTTTTATGCATGAACTTTTC	59.122	34.615	10.16	0.00	0.00	2.29

Showing 1 to 25 of 105 entries

Previous1 2 3 4 5Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self end TH	Hairpin	End Stability
2	3	7.983484	GGATGTATGAAAGCCTCAAAAATCATT	59.017	33.333	0.00	37.67	2.57
3	4	7.418254	GGGATGTATGAAAGCCTCAAAAATCAT	60.418	37.037	0.00	37.67	2.45
4	5	6.127366	GGGATGTATGAAAGCCTCAAAAATCA	60.127	38.462	0.00	37.67	2.57
5	6	6.276091	GGGATGTATGAAAGCCTCAAAAATC	58.724	40.000	0.00	37.67	2.17
6	7	5.129320	GGGGATGTATGAAAGCCTCAAAAAT	59.871	40.000	0.00	37.67	1.82
7	8	4.466015	GGGGATGTATGAAAGCCTCAAAAA	59.534	41.667	0.00	37.67	1.94
8	9	4.023291	GGGGATGTATGAAAGCCTCAAAA	58.977	43.478	0.00	37.67	2.44
9	10	3.011144	TGGGGATGTATGAAAGCCTCAAA	59.989	43.478	0.00	37.67	2.69
10	11	2.580322	TGGGGATGTATGAAAGCCTCAA	59.420	45.455	0.00	37.67	3.02
11	12	2.204463	TGGGGATGTATGAAAGCCTCA	58.796	47.619	0.00	38.81	3.86
12	13	3.515602	ATGGGGATGTATGAAAGCCTC	57.484	47.619	0.00	0.00	4.70
13	14	3.979501	AATGGGGATGTATGAAAGCCT	57.020	42.857	0.00	0.00	4.58
14	15	5.357742	AAAAATGGGGATGTATGAAAGCC	57.642	39.130	0.00	0.00	4.35
15	16	6.424812	GCATAAAAATGGGGATGTATGAAAGC	59.575	38.462	0.00	0.00	3.51
16	17	7.499292	TGCATAAAAATGGGGATGTATGAAAG	58.501	34.615	0.00	0.00	2.62
17	18	7.429374	TGCATAAAAATGGGGATGTATGAAA	57.571	32.000	0.00	0.00	2.69
18	19	7.289549	TCATGCATAAAAATGGGGATGTATGAA	59.710	33.333	0.00	43.71	2.57
19	20	6.781507	TCATGCATAAAAATGGGGATGTATGA	59.218	34.615	9.49	44.14	2.15
20	21	6.995364	TCATGCATAAAAATGGGGATGTATG	58.005	36.000	5.70	41.20	2.39
21	22	7.290714	AGTTCATGCATAAAAATGGGGATGTAT	59.709	33.333	0.00	31.92	2.29
22	23	6.610830	AGTTCATGCATAAAAATGGGGATGTA	59.389	34.615	0.00	31.92	2.29
23	24	5.426185	AGTTCATGCATAAAAATGGGGATGT	59.574	36.000	0.00	31.92	3.06
24	25	5.920903	AGTTCATGCATAAAAATGGGGATG	58.079	37.500	0.00	0.00	3.51
25	26	6.564557	AAGTTCATGCATAAAAATGGGGAT	57.435	33.333	0.00	0.00	3.85
26	27	6.371595	AAAGTTCATGCATAAAAATGGGGA	57.628	33.333	0.00	0.00	4.81

Showing 1 to 25 of 120 entries

Previous1 2 3 4 5Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.