Multiple sequence alignment - TraesCS2B01G128100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G128100 chr2B 100.000 2390 0 0 1 2390 95945026 95947415 0 4414
1 TraesCS2B01G128100 chr2B 97.674 2408 36 12 2 2390 95953283 95955689 0 4119
2 TraesCS2B01G128100 chr2B 96.782 2393 71 6 1 2390 95986154 95988543 0 3988
3 TraesCS2B01G128100 chr2B 96.421 2403 71 11 1 2390 95994449 95996849 0 3947
4 TraesCS2B01G128100 chr2B 96.083 2400 80 9 1 2390 96019748 96022143 0 3899
5 TraesCS2B01G128100 chr2B 96.043 1946 69 4 445 2390 95903399 95905336 0 3160
6 TraesCS2B01G128100 chr2B 96.095 1306 46 3 1090 2390 96003909 96005214 0 2124
7 TraesCS2B01G128100 chr2B 96.688 1268 40 2 1123 2390 95979101 95980366 0 2108
8 TraesCS2B01G128100 chr2B 97.701 1131 23 3 1 1130 95960933 95962061 0 1941
9 TraesCS2B01G128100 chr2B 92.130 1258 85 7 1136 2390 96045903 96047149 0 1762
10 TraesCS2B01G128100 chr2B 97.230 1011 23 2 1 1011 96002707 96003712 0 1707
11 TraesCS2B01G128100 chr2A 90.532 1880 119 17 1 1836 61772616 61774480 0 2431
12 TraesCS2B01G128100 chr2A 91.336 1235 95 6 838 2070 61783506 61784730 0 1677
13 TraesCS2B01G128100 chr2D 91.412 1735 90 16 1 1717 61271456 61273149 0 2324
14 TraesCS2B01G128100 chr2D 93.696 460 23 4 1 457 61287366 61287822 0 684


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G128100 chr2B 95945026 95947415 2389 False 4414.0 4414 100.0000 1 2390 1 chr2B.!!$F2 2389
1 TraesCS2B01G128100 chr2B 95953283 95955689 2406 False 4119.0 4119 97.6740 2 2390 1 chr2B.!!$F3 2388
2 TraesCS2B01G128100 chr2B 95986154 95988543 2389 False 3988.0 3988 96.7820 1 2390 1 chr2B.!!$F6 2389
3 TraesCS2B01G128100 chr2B 95994449 95996849 2400 False 3947.0 3947 96.4210 1 2390 1 chr2B.!!$F7 2389
4 TraesCS2B01G128100 chr2B 96019748 96022143 2395 False 3899.0 3899 96.0830 1 2390 1 chr2B.!!$F8 2389
5 TraesCS2B01G128100 chr2B 95903399 95905336 1937 False 3160.0 3160 96.0430 445 2390 1 chr2B.!!$F1 1945
6 TraesCS2B01G128100 chr2B 95979101 95980366 1265 False 2108.0 2108 96.6880 1123 2390 1 chr2B.!!$F5 1267
7 TraesCS2B01G128100 chr2B 95960933 95962061 1128 False 1941.0 1941 97.7010 1 1130 1 chr2B.!!$F4 1129
8 TraesCS2B01G128100 chr2B 96002707 96005214 2507 False 1915.5 2124 96.6625 1 2390 2 chr2B.!!$F10 2389
9 TraesCS2B01G128100 chr2B 96045903 96047149 1246 False 1762.0 1762 92.1300 1136 2390 1 chr2B.!!$F9 1254
10 TraesCS2B01G128100 chr2A 61772616 61774480 1864 False 2431.0 2431 90.5320 1 1836 1 chr2A.!!$F1 1835
11 TraesCS2B01G128100 chr2A 61783506 61784730 1224 False 1677.0 1677 91.3360 838 2070 1 chr2A.!!$F2 1232
12 TraesCS2B01G128100 chr2D 61271456 61273149 1693 False 2324.0 2324 91.4120 1 1717 1 chr2D.!!$F1 1716

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
938 981 1.141053 AGTGAAACACGGGAGAAAGCT 59.859 47.619 0.0 0.0 41.43 3.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2071 2256 1.285667 TCCCACGACACAGATACCCTA 59.714 52.381 0.0 0.0 0.0 3.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
549 591 9.565090 CACCTAGATTTGATGAATTATTCCTCA 57.435 33.333 8.47 8.47 33.40 3.86
930 973 2.093658 ACCATAGCTAGTGAAACACGGG 60.094 50.000 0.00 0.00 41.43 5.28
938 981 1.141053 AGTGAAACACGGGAGAAAGCT 59.859 47.619 0.00 0.00 41.43 3.74
1098 1274 7.821359 CCTCTCTCTGTTTCATAATTCTTGTCA 59.179 37.037 0.00 0.00 0.00 3.58
1147 1323 7.744087 AACTGATCTGTGCTTGTTTACATAA 57.256 32.000 5.96 0.00 0.00 1.90
1180 1356 1.166129 GTGTCAGGCAGTCTCTCGTA 58.834 55.000 0.00 0.00 0.00 3.43
1618 1800 0.032130 AGAACGAGCAAGCAACGAGA 59.968 50.000 15.68 0.00 0.00 4.04
1686 1871 1.257936 CCGCTGTCAATGTACGCATAC 59.742 52.381 0.00 0.00 34.39 2.39
1717 1902 1.375523 GGCGGAGAAAAGAAGCCGA 60.376 57.895 0.00 0.00 46.29 5.54
2071 2256 0.828343 GGCCGGCCATAGACTAGTCT 60.828 60.000 40.73 27.72 38.66 3.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
549 591 8.995577 GGTAGGATCTCTACTCTATATGGTACT 58.004 40.741 16.24 0.00 45.78 2.73
930 973 6.071840 TGTGGTTTCTAGTCTAGAGCTTTCTC 60.072 42.308 9.52 2.73 39.65 2.87
938 981 7.759886 CGATCAATTTGTGGTTTCTAGTCTAGA 59.240 37.037 5.41 5.41 0.00 2.43
1072 1148 7.821359 TGACAAGAATTATGAAACAGAGAGAGG 59.179 37.037 0.00 0.00 0.00 3.69
1147 1323 0.392706 TGACACACTGAGGCATCGTT 59.607 50.000 0.00 0.00 0.00 3.85
1618 1800 6.441093 GATCTGAGCGATCTCTATCATCTT 57.559 41.667 0.90 0.00 44.21 2.40
2024 2209 2.542020 TCTTCATTGTCTTCCGCACA 57.458 45.000 0.00 0.00 0.00 4.57
2025 2210 2.352960 GGATCTTCATTGTCTTCCGCAC 59.647 50.000 0.00 0.00 0.00 5.34
2071 2256 1.285667 TCCCACGACACAGATACCCTA 59.714 52.381 0.00 0.00 0.00 3.53
2259 2446 2.579873 GCCATGATACAAGCTGTCCAT 58.420 47.619 0.00 0.00 0.00 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.