Multiple sequence alignment - TraesCS2B01G120400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G120400 chr2B 100.000 2447 0 0 1 2447 87959280 87961726 0 4519
1 TraesCS2B01G120400 chr2B 98.392 2301 28 2 1 2292 449203847 449201547 0 4036
2 TraesCS2B01G120400 chr3B 97.800 2455 46 1 1 2447 201584602 201582148 0 4228
3 TraesCS2B01G120400 chr3B 97.720 2456 46 3 1 2447 92236950 92239404 0 4217
4 TraesCS2B01G120400 chr3B 97.719 2455 46 3 1 2447 92227466 92225014 0 4215
5 TraesCS2B01G120400 chr1B 96.950 2459 57 5 1 2447 135100555 135098103 0 4109
6 TraesCS2B01G120400 chr1B 96.703 1820 47 5 1 1808 135059518 135057700 0 3016
7 TraesCS2B01G120400 chr1B 98.380 926 10 2 1 922 339012800 339013724 0 1622
8 TraesCS2B01G120400 chr1B 98.056 926 11 3 1 922 338937103 338938025 0 1604
9 TraesCS2B01G120400 chr4D 96.776 1613 45 4 842 2447 97361819 97363431 0 2684
10 TraesCS2B01G120400 chr6B 96.280 1613 53 1 842 2447 625537413 625535801 0 2639
11 TraesCS2B01G120400 chr6B 97.732 926 14 6 1 922 388026212 388027134 0 1587
12 TraesCS2B01G120400 chr3D 96.280 1613 53 1 842 2447 498443832 498445444 0 2639
13 TraesCS2B01G120400 chr3D 97.927 965 13 1 1490 2447 478089711 478088747 0 1664
14 TraesCS2B01G120400 chr4A 95.539 1614 64 2 842 2447 350191115 350189502 0 2575
15 TraesCS2B01G120400 chr4A 96.222 1350 42 3 1106 2447 350160572 350161920 0 2202
16 TraesCS2B01G120400 chr1A 96.905 1034 22 3 1424 2447 94740928 94739895 0 1724


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G120400 chr2B 87959280 87961726 2446 False 4519 4519 100.000 1 2447 1 chr2B.!!$F1 2446
1 TraesCS2B01G120400 chr2B 449201547 449203847 2300 True 4036 4036 98.392 1 2292 1 chr2B.!!$R1 2291
2 TraesCS2B01G120400 chr3B 201582148 201584602 2454 True 4228 4228 97.800 1 2447 1 chr3B.!!$R2 2446
3 TraesCS2B01G120400 chr3B 92236950 92239404 2454 False 4217 4217 97.720 1 2447 1 chr3B.!!$F1 2446
4 TraesCS2B01G120400 chr3B 92225014 92227466 2452 True 4215 4215 97.719 1 2447 1 chr3B.!!$R1 2446
5 TraesCS2B01G120400 chr1B 135098103 135100555 2452 True 4109 4109 96.950 1 2447 1 chr1B.!!$R2 2446
6 TraesCS2B01G120400 chr1B 135057700 135059518 1818 True 3016 3016 96.703 1 1808 1 chr1B.!!$R1 1807
7 TraesCS2B01G120400 chr1B 339012800 339013724 924 False 1622 1622 98.380 1 922 1 chr1B.!!$F2 921
8 TraesCS2B01G120400 chr1B 338937103 338938025 922 False 1604 1604 98.056 1 922 1 chr1B.!!$F1 921
9 TraesCS2B01G120400 chr4D 97361819 97363431 1612 False 2684 2684 96.776 842 2447 1 chr4D.!!$F1 1605
10 TraesCS2B01G120400 chr6B 625535801 625537413 1612 True 2639 2639 96.280 842 2447 1 chr6B.!!$R1 1605
11 TraesCS2B01G120400 chr6B 388026212 388027134 922 False 1587 1587 97.732 1 922 1 chr6B.!!$F1 921
12 TraesCS2B01G120400 chr3D 498443832 498445444 1612 False 2639 2639 96.280 842 2447 1 chr3D.!!$F1 1605
13 TraesCS2B01G120400 chr3D 478088747 478089711 964 True 1664 1664 97.927 1490 2447 1 chr3D.!!$R1 957
14 TraesCS2B01G120400 chr4A 350189502 350191115 1613 True 2575 2575 95.539 842 2447 1 chr4A.!!$R1 1605
15 TraesCS2B01G120400 chr4A 350160572 350161920 1348 False 2202 2202 96.222 1106 2447 1 chr4A.!!$F1 1341
16 TraesCS2B01G120400 chr1A 94739895 94740928 1033 True 1724 1724 96.905 1424 2447 1 chr1A.!!$R1 1023

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
695 701 1.997606 CGAACCGACCGCTTTAAGAAT 59.002 47.619 0.0 0.0 0.0 2.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2319 2337 1.066143 TCTCGGATGGTTTCTGAAGCC 60.066 52.381 15.49 15.49 39.28 4.35 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
293 294 4.546829 AGCGACTTGGGTTGACTTATAA 57.453 40.909 0.00 0.0 0.00 0.98
695 701 1.997606 CGAACCGACCGCTTTAAGAAT 59.002 47.619 0.00 0.0 0.00 2.40
838 844 6.735678 TGTTCACGTTACATGCTAAATCAT 57.264 33.333 0.00 0.0 0.00 2.45
1082 1088 3.508762 TCGATGGTAAAAGAACGAGAGC 58.491 45.455 0.00 0.0 0.00 4.09
1297 1303 1.896220 TGGAGCAGCTTTCAAACGAT 58.104 45.000 0.00 0.0 0.00 3.73
1302 1308 4.494855 GGAGCAGCTTTCAAACGATGTATC 60.495 45.833 0.00 0.0 0.00 2.24
1426 1432 2.778299 CTTCCACCAATCGGAGTTTCA 58.222 47.619 0.00 0.0 33.01 2.69
1796 1814 3.785364 AGAGAGGGAAAGAGTGCTAGTT 58.215 45.455 0.00 0.0 0.00 2.24
2053 2071 0.826062 TGAGGCTGCATCAATCGAGA 59.174 50.000 15.28 0.0 0.00 4.04
2273 2291 6.833933 AGTTTCTTAGTCTTTTGGTCCATGTT 59.166 34.615 0.00 0.0 0.00 2.71
2319 2337 9.617975 GTTTCTTTCTTTTACAAGATCATGGAG 57.382 33.333 2.59 0.0 38.89 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
293 294 8.041323 AGTGTCCTTTCTCGATACATAACATTT 58.959 33.333 0.00 0.00 0.00 2.32
695 701 4.586421 ACTGAGTGAGAGAAGACAATCACA 59.414 41.667 6.91 0.00 43.55 3.58
940 946 4.143030 CGATGATGAGGCCGATAAATTGAC 60.143 45.833 0.00 0.00 0.00 3.18
1050 1056 5.527214 TCTTTTACCATCGATCATGCGAAAT 59.473 36.000 0.00 0.00 44.22 2.17
1297 1303 7.004691 TCTAAGCTTATCCTGTAGCTGATACA 58.995 38.462 6.64 5.57 46.53 2.29
1302 1308 6.398234 TTCTCTAAGCTTATCCTGTAGCTG 57.602 41.667 6.64 0.00 46.53 4.24
1426 1432 2.779755 TACCACCATCTGAAATGCGT 57.220 45.000 0.00 0.00 0.00 5.24
1643 1661 5.579976 ACCTGAGGTGAGGTTGGAACAAC 62.580 52.174 1.77 3.63 44.53 3.32
1796 1814 2.631160 TCCCTTGCTTGTTCTTTCGA 57.369 45.000 0.00 0.00 0.00 3.71
2053 2071 9.832445 ATCTAACAATTCCTTATGTCGTGTATT 57.168 29.630 0.00 0.00 0.00 1.89
2319 2337 1.066143 TCTCGGATGGTTTCTGAAGCC 60.066 52.381 15.49 15.49 39.28 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.