Multiple sequence alignment - TraesCS2B01G120000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G120000 chr2B 100.000 2442 0 0 1 2442 87791487 87793928 0 4510
1 TraesCS2B01G120000 chr1B 96.930 2443 70 3 1 2440 661028326 661030766 0 4091
2 TraesCS2B01G120000 chr1B 95.913 2447 92 5 1 2442 584636730 584634287 0 3958
3 TraesCS2B01G120000 chr7B 96.811 2446 73 2 1 2442 112898384 112900828 0 4080
4 TraesCS2B01G120000 chr4B 96.956 2431 68 4 1 2428 554204776 554207203 0 4074
5 TraesCS2B01G120000 chr4B 96.566 2446 76 5 1 2442 646936507 646938948 0 4045
6 TraesCS2B01G120000 chr4B 96.214 2430 86 3 4 2428 95357242 95354814 0 3973
7 TraesCS2B01G120000 chr3B 96.321 2446 84 3 1 2442 48679967 48682410 0 4013
8 TraesCS2B01G120000 chr5B 96.237 2445 82 5 1 2442 246865147 246862710 0 3997
9 TraesCS2B01G120000 chr5B 96.199 2447 83 7 1 2442 541962814 541965255 0 3995


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G120000 chr2B 87791487 87793928 2441 False 4510 4510 100.000 1 2442 1 chr2B.!!$F1 2441
1 TraesCS2B01G120000 chr1B 661028326 661030766 2440 False 4091 4091 96.930 1 2440 1 chr1B.!!$F1 2439
2 TraesCS2B01G120000 chr1B 584634287 584636730 2443 True 3958 3958 95.913 1 2442 1 chr1B.!!$R1 2441
3 TraesCS2B01G120000 chr7B 112898384 112900828 2444 False 4080 4080 96.811 1 2442 1 chr7B.!!$F1 2441
4 TraesCS2B01G120000 chr4B 554204776 554207203 2427 False 4074 4074 96.956 1 2428 1 chr4B.!!$F1 2427
5 TraesCS2B01G120000 chr4B 646936507 646938948 2441 False 4045 4045 96.566 1 2442 1 chr4B.!!$F2 2441
6 TraesCS2B01G120000 chr4B 95354814 95357242 2428 True 3973 3973 96.214 4 2428 1 chr4B.!!$R1 2424
7 TraesCS2B01G120000 chr3B 48679967 48682410 2443 False 4013 4013 96.321 1 2442 1 chr3B.!!$F1 2441
8 TraesCS2B01G120000 chr5B 246862710 246865147 2437 True 3997 3997 96.237 1 2442 1 chr5B.!!$R1 2441
9 TraesCS2B01G120000 chr5B 541962814 541965255 2441 False 3995 3995 96.199 1 2442 1 chr5B.!!$F1 2441

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
539 542 1.328279 TGCGGGATCGACTACATCAT 58.672 50.000 0.0 0.0 39.0 2.45 F
1338 1349 3.921119 TGTTGCCACATCTGAATTGAC 57.079 42.857 0.0 0.0 0.0 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1440 1455 0.332972 GGGGACAATTCTGCCTTCCT 59.667 55.000 0.00 0.0 0.0 3.36 R
2220 2235 3.890756 TCTGCCATGTTAATTATGCTGGG 59.109 43.478 8.81 0.0 0.0 4.45 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
539 542 1.328279 TGCGGGATCGACTACATCAT 58.672 50.000 0.00 0.00 39.00 2.45
696 699 6.897966 TGAAGAAATATGTGAGTACTCCTCCT 59.102 38.462 20.11 8.84 39.65 3.69
788 793 7.647062 ATGTTTTCATGTGGCAACAGCTGTT 62.647 40.000 26.36 26.36 39.84 3.16
974 984 6.767902 TGTTCTTTATGTGAACTCTGCTTCTT 59.232 34.615 7.89 0.00 42.86 2.52
1338 1349 3.921119 TGTTGCCACATCTGAATTGAC 57.079 42.857 0.00 0.00 0.00 3.18
1395 1406 6.706270 GTGTTCACCTGACTCTTTTTCTCATA 59.294 38.462 0.00 0.00 0.00 2.15
1640 1655 3.005050 CCGGACGCATACCTTACATTCTA 59.995 47.826 0.00 0.00 0.00 2.10
1660 1675 2.107950 TTGCCGAGGAATGTAAGGTG 57.892 50.000 0.00 0.00 0.00 4.00
1813 1828 3.247006 CCTACTTAGGCGTGACAACAT 57.753 47.619 0.00 0.00 36.53 2.71
1884 1899 1.001815 CCCGTTTGCTGTTTCGAATGT 60.002 47.619 0.00 0.00 0.00 2.71
1922 1937 9.729023 TTAAAACATGGCAAATATACTTCATCG 57.271 29.630 0.00 0.00 0.00 3.84
1971 1986 2.548057 TGTTCATTTGGACGTCTTGCTC 59.452 45.455 16.46 0.00 0.00 4.26
2040 2055 1.318576 GTAGCCACAACCTTTGCTGT 58.681 50.000 0.00 0.00 35.34 4.40
2220 2235 3.315191 ACAGTACAAACAACATGGCAGAC 59.685 43.478 0.00 0.00 0.00 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
198 199 1.250840 GCCCTCGCATTTCCAAACCT 61.251 55.000 0.00 0.00 34.03 3.50
359 362 7.773690 GGAAGGATCATGCCTACTAAGTAAAAA 59.226 37.037 0.00 0.00 37.26 1.94
447 450 0.245539 CACCCAGGTCGACATACGTT 59.754 55.000 18.91 0.00 43.13 3.99
453 456 0.608130 CAAGATCACCCAGGTCGACA 59.392 55.000 18.91 0.00 0.00 4.35
539 542 3.884693 GGCACACACATCCATATGATTGA 59.115 43.478 3.65 0.00 36.54 2.57
741 746 2.223688 TGCCACATAAACACAAGTGCAC 60.224 45.455 9.40 9.40 0.00 4.57
788 793 2.618442 TCAAGATGACAGTGTGCACA 57.382 45.000 17.42 17.42 0.00 4.57
828 833 9.019656 TGTATTTTACTATCAAGTTGCCACATT 57.980 29.630 0.00 0.00 37.15 2.71
974 984 8.855110 TGACCTGCATTTAAAAGTGAAGAAATA 58.145 29.630 0.00 0.00 0.00 1.40
1338 1349 4.413087 ACAGACGTAGCAAAAGATAGACG 58.587 43.478 0.00 0.00 36.42 4.18
1395 1406 1.002087 GAAATCCACAGTCCGTCCTGT 59.998 52.381 0.00 0.00 46.40 4.00
1411 1426 4.472286 CAAAGTATTCCAACGCGTGAAAT 58.528 39.130 14.98 15.29 0.00 2.17
1421 1436 6.208599 CCTTCCTACTTTGCAAAGTATTCCAA 59.791 38.462 38.72 28.18 46.87 3.53
1440 1455 0.332972 GGGGACAATTCTGCCTTCCT 59.667 55.000 0.00 0.00 0.00 3.36
1640 1655 2.643551 CACCTTACATTCCTCGGCAAT 58.356 47.619 0.00 0.00 0.00 3.56
1660 1675 6.467723 TTTGACGAGAACAAAAGAGATAGC 57.532 37.500 0.00 0.00 34.89 2.97
1912 1927 4.632153 GCTAACCATGTCCGATGAAGTAT 58.368 43.478 0.00 0.00 0.00 2.12
1915 1930 1.860950 CGCTAACCATGTCCGATGAAG 59.139 52.381 0.00 0.00 0.00 3.02
1922 1937 0.997196 GACGTTCGCTAACCATGTCC 59.003 55.000 0.00 0.00 31.46 4.02
1971 1986 7.010552 CGGTGAAGTTAGTGATGAAATAGAAGG 59.989 40.741 0.00 0.00 0.00 3.46
2040 2055 0.797542 GGCGTAACGTGCATAAACCA 59.202 50.000 0.00 0.00 0.00 3.67
2220 2235 3.890756 TCTGCCATGTTAATTATGCTGGG 59.109 43.478 8.81 0.00 0.00 4.45
2380 2467 7.340999 TCTGCCATGTTATGTGTAGTTAGTCTA 59.659 37.037 0.00 0.00 0.00 2.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.