Multiple sequence alignment - TraesCS2B01G086000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G086000 chr2B 100.000 2926 0 0 1 2926 47774984 47777909 0.000000e+00 5404.0
1 TraesCS2B01G086000 chr2B 99.009 2926 29 0 1 2926 47745299 47748224 0.000000e+00 5243.0
2 TraesCS2B01G086000 chr2B 98.360 2926 30 2 1 2926 47816952 47819859 0.000000e+00 5121.0
3 TraesCS2B01G086000 chr2B 98.592 2770 39 0 1 2770 47697854 47700623 0.000000e+00 4900.0
4 TraesCS2B01G086000 chr2B 98.556 2770 40 0 1 2770 47718822 47721591 0.000000e+00 4894.0
5 TraesCS2B01G086000 chr2B 98.528 815 12 0 1 815 47692435 47693249 0.000000e+00 1439.0
6 TraesCS2B01G086000 chr2B 96.000 50 2 0 2877 2926 796269596 796269547 6.720000e-12 82.4
7 TraesCS2B01G086000 chr2D 93.429 1674 91 6 313 1969 29686647 29688318 0.000000e+00 2464.0
8 TraesCS2B01G086000 chr2D 77.751 836 160 18 1122 1935 29531869 29531038 9.420000e-135 490.0
9 TraesCS2B01G086000 chr2D 92.135 89 7 0 181 269 351973438 351973350 3.060000e-25 126.0
10 TraesCS2B01G086000 chrUn 98.660 1269 17 0 1502 2770 344072828 344071560 0.000000e+00 2250.0
11 TraesCS2B01G086000 chrUn 98.660 1269 17 0 1502 2770 344119251 344120519 0.000000e+00 2250.0
12 TraesCS2B01G086000 chr2A 89.671 1704 139 17 293 1977 31897862 31899547 0.000000e+00 2137.0
13 TraesCS2B01G086000 chr2A 88.633 695 70 4 2096 2785 31899603 31900293 0.000000e+00 837.0
14 TraesCS2B01G086000 chr2A 86.726 113 11 3 161 269 638683801 638683689 3.960000e-24 122.0
15 TraesCS2B01G086000 chr7A 78.097 1114 216 23 836 1935 725231392 725230293 0.000000e+00 680.0
16 TraesCS2B01G086000 chr7A 77.778 504 94 13 836 1328 725311233 725310737 7.930000e-76 294.0
17 TraesCS2B01G086000 chr3B 86.486 111 15 0 160 270 581965984 581966094 3.960000e-24 122.0
18 TraesCS2B01G086000 chr7D 85.965 114 15 1 163 276 20285674 20285562 1.420000e-23 121.0
19 TraesCS2B01G086000 chr6B 98.000 50 1 0 2877 2926 280621022 280620973 1.440000e-13 87.9
20 TraesCS2B01G086000 chr5B 96.000 50 2 0 2877 2926 318089692 318089643 6.720000e-12 82.4
21 TraesCS2B01G086000 chr5A 96.000 50 2 0 2877 2926 273726585 273726634 6.720000e-12 82.4
22 TraesCS2B01G086000 chr1A 96.000 50 2 0 2877 2926 153661307 153661258 6.720000e-12 82.4
23 TraesCS2B01G086000 chr4B 92.453 53 4 0 2874 2926 574298792 574298844 3.130000e-10 76.8
24 TraesCS2B01G086000 chr3D 94.000 50 3 0 2877 2926 558571023 558571072 3.130000e-10 76.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G086000 chr2B 47774984 47777909 2925 False 5404 5404 100.000 1 2926 1 chr2B.!!$F5 2925
1 TraesCS2B01G086000 chr2B 47745299 47748224 2925 False 5243 5243 99.009 1 2926 1 chr2B.!!$F4 2925
2 TraesCS2B01G086000 chr2B 47816952 47819859 2907 False 5121 5121 98.360 1 2926 1 chr2B.!!$F6 2925
3 TraesCS2B01G086000 chr2B 47697854 47700623 2769 False 4900 4900 98.592 1 2770 1 chr2B.!!$F2 2769
4 TraesCS2B01G086000 chr2B 47718822 47721591 2769 False 4894 4894 98.556 1 2770 1 chr2B.!!$F3 2769
5 TraesCS2B01G086000 chr2B 47692435 47693249 814 False 1439 1439 98.528 1 815 1 chr2B.!!$F1 814
6 TraesCS2B01G086000 chr2D 29686647 29688318 1671 False 2464 2464 93.429 313 1969 1 chr2D.!!$F1 1656
7 TraesCS2B01G086000 chr2D 29531038 29531869 831 True 490 490 77.751 1122 1935 1 chr2D.!!$R1 813
8 TraesCS2B01G086000 chrUn 344071560 344072828 1268 True 2250 2250 98.660 1502 2770 1 chrUn.!!$R1 1268
9 TraesCS2B01G086000 chrUn 344119251 344120519 1268 False 2250 2250 98.660 1502 2770 1 chrUn.!!$F1 1268
10 TraesCS2B01G086000 chr2A 31897862 31900293 2431 False 1487 2137 89.152 293 2785 2 chr2A.!!$F1 2492
11 TraesCS2B01G086000 chr7A 725230293 725231392 1099 True 680 680 78.097 836 1935 1 chr7A.!!$R1 1099

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
995 1000 2.276732 CCTGGTGAAGGCTTTCTCAA 57.723 50.0 10.19 0.0 39.93 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2661 2710 0.106708 GACAGTCTTGGGCAGTGTCA 59.893 55.0 0.0 0.0 37.94 3.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
71 72 8.565896 AACATCAGTATTTCTATGAAAGCACA 57.434 30.769 0.00 0.0 0.00 4.57
81 82 4.994852 TCTATGAAAGCACACTACACCAAC 59.005 41.667 0.00 0.0 0.00 3.77
241 242 6.737720 AGTGCTAGATACATCCATTTGAGA 57.262 37.500 0.00 0.0 0.00 3.27
955 960 6.234920 TCAAATTTCTATCTCACCCGTTTCA 58.765 36.000 0.00 0.0 0.00 2.69
995 1000 2.276732 CCTGGTGAAGGCTTTCTCAA 57.723 50.000 10.19 0.0 39.93 3.02
1498 1517 3.739300 CCGTGCCACTTTATAGGTAATCG 59.261 47.826 0.00 0.0 0.00 3.34
1704 1748 1.619654 TGGTGGTTTCAGATTGCCAG 58.380 50.000 0.00 0.0 0.00 4.85
2018 2062 4.960469 TCTACCAGATCCCTCGTTGTTTAT 59.040 41.667 0.00 0.0 0.00 1.40
2019 2063 4.138487 ACCAGATCCCTCGTTGTTTATC 57.862 45.455 0.00 0.0 0.00 1.75
2661 2710 0.475828 AAAGCCCACACTACCCTCCT 60.476 55.000 0.00 0.0 0.00 3.69
2667 2716 1.633774 CACACTACCCTCCTGACACT 58.366 55.000 0.00 0.0 0.00 3.55
2885 2934 3.388024 ACCTACACGCCAATGATGTCTAT 59.612 43.478 0.00 0.0 0.00 1.98
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
67 68 7.527084 TTTTAATTTTGTTGGTGTAGTGTGC 57.473 32.000 0.00 0.00 0.00 4.57
71 72 8.147704 CCCTGATTTTAATTTTGTTGGTGTAGT 58.852 33.333 0.00 0.00 0.00 2.73
241 242 8.986991 ACTCTCTCAAATCCATATTACTTGTCT 58.013 33.333 0.00 0.00 0.00 3.41
259 260 8.242053 CCGAGTTAACAAAATACTACTCTCTCA 58.758 37.037 8.61 0.00 32.03 3.27
880 885 7.606456 GTCTGGTATATTCCAACTCTTTGTTCA 59.394 37.037 2.41 0.00 36.63 3.18
955 960 4.020485 AGGCTTGTGAATAAGTAGTTCGGT 60.020 41.667 0.00 0.00 0.00 4.69
994 999 3.820557 AGACAGTAGCCAACATGTTGTT 58.179 40.909 31.20 22.57 42.08 2.83
995 1000 3.492102 AGACAGTAGCCAACATGTTGT 57.508 42.857 31.20 19.44 38.85 3.32
1498 1517 6.851222 AATATTGTGCATATATAGCGAGGC 57.149 37.500 0.00 0.00 33.85 4.70
1704 1748 2.354259 CCTCTGCATTTCTCTGACACC 58.646 52.381 0.00 0.00 0.00 4.16
2018 2062 9.899661 ATTATAACAAGTAACCATGCAAGTAGA 57.100 29.630 0.00 0.00 0.00 2.59
2143 2187 5.418840 TGCCTATGGTTTCATTTCTTCCTTC 59.581 40.000 0.00 0.00 34.96 3.46
2661 2710 0.106708 GACAGTCTTGGGCAGTGTCA 59.893 55.000 0.00 0.00 37.94 3.58
2667 2716 2.741092 GTCCGACAGTCTTGGGCA 59.259 61.111 0.00 0.00 0.00 5.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.