Multiple sequence alignment - TraesCS2B01G070200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G070200 chr2B 100.000 3832 0 0 1 3832 37231804 37235635 0.000000e+00 7077.0
1 TraesCS2B01G070200 chr2B 99.426 3832 22 0 1 3832 37248962 37252793 0.000000e+00 6955.0
2 TraesCS2B01G070200 chr2B 99.534 2577 12 0 1151 3727 37215745 37218321 0.000000e+00 4693.0
3 TraesCS2B01G070200 chr2B 90.206 3594 236 60 274 3832 37357250 37360762 0.000000e+00 4580.0
4 TraesCS2B01G070200 chr2B 89.864 3305 235 49 564 3827 37014456 37017701 0.000000e+00 4156.0
5 TraesCS2B01G070200 chr2B 95.391 998 42 4 2837 3832 37142945 37143940 0.000000e+00 1585.0
6 TraesCS2B01G070200 chr2B 99.409 508 3 0 1 508 37215240 37215747 0.000000e+00 922.0
7 TraesCS2B01G070200 chr2B 88.571 280 32 0 1 280 37356796 37357075 1.320000e-89 340.0
8 TraesCS2B01G070200 chr1A 87.394 3181 254 73 1 3123 534356054 534359145 0.000000e+00 3517.0
9 TraesCS2B01G070200 chr1A 82.701 659 77 20 3179 3832 534360737 534361363 5.600000e-153 551.0
10 TraesCS2B01G070200 chr2A 87.292 3187 259 72 1 3129 24602305 24599207 0.000000e+00 3507.0
11 TraesCS2B01G070200 chr2A 87.261 3187 259 73 1 3129 24572915 24569818 0.000000e+00 3500.0
12 TraesCS2B01G070200 chr2A 87.300 3181 257 73 1 3123 25639289 25642380 0.000000e+00 3500.0
13 TraesCS2B01G070200 chr2A 85.039 1544 138 45 452 1965 24545482 24544002 0.000000e+00 1485.0
14 TraesCS2B01G070200 chr2A 82.701 659 76 20 3179 3832 24597739 24597114 5.600000e-153 551.0
15 TraesCS2B01G070200 chr2A 82.549 659 78 20 3179 3832 24568350 24567724 2.600000e-151 545.0
16 TraesCS2B01G070200 chr2A 81.559 526 54 21 886 1389 24536490 24535986 9.980000e-106 394.0
17 TraesCS2B01G070200 chr2D 84.037 2299 261 55 761 2993 23046604 23044346 0.000000e+00 2115.0
18 TraesCS2B01G070200 chr2D 81.424 646 74 25 344 966 23054726 23054104 1.600000e-133 486.0
19 TraesCS2B01G070200 chr2D 83.573 347 55 2 1 346 159863422 159863767 1.330000e-84 324.0
20 TraesCS2B01G070200 chrUn 87.553 1639 102 40 688 2277 366633513 366635098 0.000000e+00 1803.0
21 TraesCS2B01G070200 chrUn 92.398 763 40 9 2379 3129 228952553 228951797 0.000000e+00 1072.0
22 TraesCS2B01G070200 chrUn 78.411 1246 151 58 1 1207 342306830 342305664 0.000000e+00 702.0
23 TraesCS2B01G070200 chrUn 92.063 504 26 5 2636 3129 403354802 403354303 0.000000e+00 697.0
24 TraesCS2B01G070200 chrUn 92.369 498 24 5 2636 3123 457518995 457519488 0.000000e+00 697.0
25 TraesCS2B01G070200 chrUn 83.559 590 66 16 3179 3763 460996575 460996012 1.220000e-144 523.0
26 TraesCS2B01G070200 chrUn 97.222 36 1 0 3797 3832 338620166 338620131 1.150000e-05 62.1
27 TraesCS2B01G070200 chrUn 97.222 36 1 0 3797 3832 444705756 444705791 1.150000e-05 62.1
28 TraesCS2B01G070200 chr7D 85.879 347 47 2 1 346 598278164 598277819 6.050000e-98 368.0
29 TraesCS2B01G070200 chr7A 86.006 343 44 4 2 342 681581713 681581373 7.820000e-97 364.0
30 TraesCS2B01G070200 chr1D 84.615 351 46 6 1 344 437316372 437316023 3.670000e-90 342.0
31 TraesCS2B01G070200 chr1B 83.526 346 49 4 1 346 520534821 520534484 2.220000e-82 316.0
32 TraesCS2B01G070200 chr5D 82.659 346 56 4 1 344 296999077 296998734 1.730000e-78 303.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G070200 chr2B 37231804 37235635 3831 False 7077.0 7077 100.0000 1 3832 1 chr2B.!!$F3 3831
1 TraesCS2B01G070200 chr2B 37248962 37252793 3831 False 6955.0 6955 99.4260 1 3832 1 chr2B.!!$F4 3831
2 TraesCS2B01G070200 chr2B 37014456 37017701 3245 False 4156.0 4156 89.8640 564 3827 1 chr2B.!!$F1 3263
3 TraesCS2B01G070200 chr2B 37215240 37218321 3081 False 2807.5 4693 99.4715 1 3727 2 chr2B.!!$F5 3726
4 TraesCS2B01G070200 chr2B 37356796 37360762 3966 False 2460.0 4580 89.3885 1 3832 2 chr2B.!!$F6 3831
5 TraesCS2B01G070200 chr2B 37142945 37143940 995 False 1585.0 1585 95.3910 2837 3832 1 chr2B.!!$F2 995
6 TraesCS2B01G070200 chr1A 534356054 534361363 5309 False 2034.0 3517 85.0475 1 3832 2 chr1A.!!$F1 3831
7 TraesCS2B01G070200 chr2A 25639289 25642380 3091 False 3500.0 3500 87.3000 1 3123 1 chr2A.!!$F1 3122
8 TraesCS2B01G070200 chr2A 24597114 24602305 5191 True 2029.0 3507 84.9965 1 3832 2 chr2A.!!$R4 3831
9 TraesCS2B01G070200 chr2A 24567724 24572915 5191 True 2022.5 3500 84.9050 1 3832 2 chr2A.!!$R3 3831
10 TraesCS2B01G070200 chr2A 24544002 24545482 1480 True 1485.0 1485 85.0390 452 1965 1 chr2A.!!$R2 1513
11 TraesCS2B01G070200 chr2A 24535986 24536490 504 True 394.0 394 81.5590 886 1389 1 chr2A.!!$R1 503
12 TraesCS2B01G070200 chr2D 23044346 23046604 2258 True 2115.0 2115 84.0370 761 2993 1 chr2D.!!$R1 2232
13 TraesCS2B01G070200 chr2D 23054104 23054726 622 True 486.0 486 81.4240 344 966 1 chr2D.!!$R2 622
14 TraesCS2B01G070200 chrUn 366633513 366635098 1585 False 1803.0 1803 87.5530 688 2277 1 chrUn.!!$F1 1589
15 TraesCS2B01G070200 chrUn 228951797 228952553 756 True 1072.0 1072 92.3980 2379 3129 1 chrUn.!!$R1 750
16 TraesCS2B01G070200 chrUn 342305664 342306830 1166 True 702.0 702 78.4110 1 1207 1 chrUn.!!$R3 1206
17 TraesCS2B01G070200 chrUn 460996012 460996575 563 True 523.0 523 83.5590 3179 3763 1 chrUn.!!$R5 584

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2487 2799 0.322816 TCAGCTTTGAGGTGGCATCC 60.323 55.0 7.23 0.0 43.47 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3741 5628 3.264947 GTGCATGTCAGCTATCTTCACA 58.735 45.455 0.0 0.0 34.99 3.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2487 2799 0.322816 TCAGCTTTGAGGTGGCATCC 60.323 55.000 7.23 0.0 43.47 3.51
3435 5313 4.982241 TGGATAATAAGGCCTTCAGAGG 57.018 45.455 24.49 0.0 46.50 3.69
3741 5628 2.572290 CCACTCCGGTCTTGACTTTTT 58.428 47.619 0.00 0.0 0.00 1.94
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2487 2799 2.512286 ATGACGCCATGCAGGTCG 60.512 61.111 0.0 0.0 40.96 4.79
3741 5628 3.264947 GTGCATGTCAGCTATCTTCACA 58.735 45.455 0.0 0.0 34.99 3.58


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.