Multiple sequence alignment - TraesCS2B01G064500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G064500 chr2B 100.000 2485 0 0 1 2485 30670612 30668128 0 4590
1 TraesCS2B01G064500 chr6B 98.956 2491 19 6 1 2485 596620323 596622812 0 4449
2 TraesCS2B01G064500 chrUn 98.795 2490 25 5 1 2485 282364697 282362208 0 4427
3 TraesCS2B01G064500 chrUn 98.755 2490 26 5 1 2485 86510013 86507524 0 4421
4 TraesCS2B01G064500 chr3B 98.674 2489 27 6 1 2485 92317837 92320323 0 4409
5 TraesCS2B01G064500 chr3B 96.060 2487 90 7 1 2485 368696997 368699477 0 4043
6 TraesCS2B01G064500 chr6A 98.235 2493 36 5 1 2485 84434143 84436635 0 4353
7 TraesCS2B01G064500 chr3D 97.990 2488 46 4 1 2485 154704961 154702475 0 4314
8 TraesCS2B01G064500 chr3A 97.751 2490 49 7 1 2485 694375571 694373084 0 4281
9 TraesCS2B01G064500 chr7A 97.229 2490 59 8 1 2485 46402292 46404776 0 4207


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G064500 chr2B 30668128 30670612 2484 True 4590 4590 100.000 1 2485 1 chr2B.!!$R1 2484
1 TraesCS2B01G064500 chr6B 596620323 596622812 2489 False 4449 4449 98.956 1 2485 1 chr6B.!!$F1 2484
2 TraesCS2B01G064500 chrUn 282362208 282364697 2489 True 4427 4427 98.795 1 2485 1 chrUn.!!$R2 2484
3 TraesCS2B01G064500 chrUn 86507524 86510013 2489 True 4421 4421 98.755 1 2485 1 chrUn.!!$R1 2484
4 TraesCS2B01G064500 chr3B 92317837 92320323 2486 False 4409 4409 98.674 1 2485 1 chr3B.!!$F1 2484
5 TraesCS2B01G064500 chr3B 368696997 368699477 2480 False 4043 4043 96.060 1 2485 1 chr3B.!!$F2 2484
6 TraesCS2B01G064500 chr6A 84434143 84436635 2492 False 4353 4353 98.235 1 2485 1 chr6A.!!$F1 2484
7 TraesCS2B01G064500 chr3D 154702475 154704961 2486 True 4314 4314 97.990 1 2485 1 chr3D.!!$R1 2484
8 TraesCS2B01G064500 chr3A 694373084 694375571 2487 True 4281 4281 97.751 1 2485 1 chr3A.!!$R1 2484
9 TraesCS2B01G064500 chr7A 46402292 46404776 2484 False 4207 4207 97.229 1 2485 1 chr7A.!!$F1 2484

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
876 879 0.037605 GTTTGATCGGGTCGACCAGT 60.038 55.0 34.4 20.77 39.18 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1687 1696 2.352421 GCCGCTGACTTTGACTGTACTA 60.352 50.0 0.0 0.0 0.0 1.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
473 476 9.145865 GAAATTCTTCACGATTTCTAGAGTTCT 57.854 33.333 0.00 0.00 32.13 3.01
747 750 5.046591 AGTGAGGATTCCATTCGAAGTAACA 60.047 40.000 3.35 0.00 32.78 2.41
876 879 0.037605 GTTTGATCGGGTCGACCAGT 60.038 55.000 34.40 20.77 39.18 4.00
886 889 4.760047 CGACCAGTTCAGGCCCGG 62.760 72.222 0.00 0.00 0.00 5.73
1290 1295 8.677148 TGGAATAATTATAGCAGGTTGTTCTC 57.323 34.615 0.00 0.00 0.00 2.87
1430 1436 4.158579 GGGCTCATAAACCCTTTCTTTCAG 59.841 45.833 0.00 0.00 43.36 3.02
1659 1668 6.659242 GGATGAAAGAACATGAGAAAGGGTTA 59.341 38.462 0.00 0.00 0.00 2.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
49 50 3.195825 GCTTTCTACTGAGGCCTGTTCTA 59.804 47.826 12.00 0.00 0.00 2.10
473 476 6.918067 ATCGATATCAGTGAAGTAATCCCA 57.082 37.500 0.00 0.00 0.00 4.37
747 750 4.574674 TTGAAGATGGTGCTCCTGTTAT 57.425 40.909 6.34 0.00 34.23 1.89
876 879 1.918293 ACTCATGACCGGGCCTGAA 60.918 57.895 16.68 0.96 0.00 3.02
1212 1217 7.549147 AATAAAGTAGCCCTATGTTCGGATA 57.451 36.000 0.00 0.00 0.00 2.59
1430 1436 0.391263 GTGACCGACCCCTTGATGAC 60.391 60.000 0.00 0.00 0.00 3.06
1687 1696 2.352421 GCCGCTGACTTTGACTGTACTA 60.352 50.000 0.00 0.00 0.00 1.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.