Multiple sequence alignment - TraesCS2B01G064400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G064400 chr2B 100.000 2300 0 0 1 2300 30669442 30667143 0 4248
1 TraesCS2B01G064400 chrUn 98.785 2304 24 4 1 2300 86508841 86506538 0 4096
2 TraesCS2B01G064400 chr6B 98.655 2305 26 4 1 2300 596621494 596623798 0 4080
3 TraesCS2B01G064400 chr6A 98.610 2302 26 4 1 2300 608882065 608879768 0 4069
4 TraesCS2B01G064400 chr6A 98.093 2307 35 5 1 2300 84435315 84437619 0 4008
5 TraesCS2B01G064400 chr3B 98.480 2303 31 4 1 2300 92319008 92321309 0 4056
6 TraesCS2B01G064400 chr4D 98.349 2301 32 3 2 2300 123424886 123427182 0 4034
7 TraesCS2B01G064400 chr1A 97.917 2304 44 3 1 2300 94784479 94786782 0 3986
8 TraesCS2B01G064400 chr5B 97.872 2303 40 6 1 2300 567269424 567267128 0 3973


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G064400 chr2B 30667143 30669442 2299 True 4248 4248 100.000 1 2300 1 chr2B.!!$R1 2299
1 TraesCS2B01G064400 chrUn 86506538 86508841 2303 True 4096 4096 98.785 1 2300 1 chrUn.!!$R1 2299
2 TraesCS2B01G064400 chr6B 596621494 596623798 2304 False 4080 4080 98.655 1 2300 1 chr6B.!!$F1 2299
3 TraesCS2B01G064400 chr6A 608879768 608882065 2297 True 4069 4069 98.610 1 2300 1 chr6A.!!$R1 2299
4 TraesCS2B01G064400 chr6A 84435315 84437619 2304 False 4008 4008 98.093 1 2300 1 chr6A.!!$F1 2299
5 TraesCS2B01G064400 chr3B 92319008 92321309 2301 False 4056 4056 98.480 1 2300 1 chr3B.!!$F1 2299
6 TraesCS2B01G064400 chr4D 123424886 123427182 2296 False 4034 4034 98.349 2 2300 1 chr4D.!!$F1 2298
7 TraesCS2B01G064400 chr1A 94784479 94786782 2303 False 3986 3986 97.917 1 2300 1 chr1A.!!$F1 2299
8 TraesCS2B01G064400 chr5B 567267128 567269424 2296 True 3973 3973 97.872 1 2300 1 chr5B.!!$R1 2299

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
260 262 4.158579 GGGCTCATAAACCCTTTCTTTCAG 59.841 45.833 0.0 0.0 43.36 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1691 1705 0.973632 TACTGCGCCTTCCTTCTTCA 59.026 50.0 4.18 0.0 0.0 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
120 121 8.677148 TGGAATAATTATAGCAGGTTGTTCTC 57.323 34.615 0.0 0.0 0.00 2.87
260 262 4.158579 GGGCTCATAAACCCTTTCTTTCAG 59.841 45.833 0.0 0.0 43.36 3.02
489 497 6.659242 GGATGAAAGAACATGAGAAAGGGTTA 59.341 38.462 0.0 0.0 0.00 2.85
1416 1429 2.158798 CCAGCCAGATGATGATGTCTGT 60.159 50.000 0.0 0.0 40.12 3.41
1607 1621 3.715648 ATCCCTGAGGTGGATAAGTCT 57.284 47.619 0.0 0.0 40.85 3.24
1691 1705 4.224147 GGGGCAATACATACCAAAAGGTTT 59.776 41.667 0.0 0.0 0.00 3.27
1743 1757 1.120530 CCCATAGCCGGTCTAACTGT 58.879 55.000 1.9 0.0 0.00 3.55
2042 2057 2.547826 GGTGGTTCCGTAATGAGTAGC 58.452 52.381 0.0 0.0 0.00 3.58
2106 2121 4.829492 CACACCTTCATTCTTTTCCTCCTT 59.171 41.667 0.0 0.0 0.00 3.36
2241 2256 2.943199 GCAGCAAGCTCCCTTCTAATGT 60.943 50.000 0.0 0.0 41.15 2.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
42 43 7.549147 AATAAAGTAGCCCTATGTTCGGATA 57.451 36.000 0.00 0.0 0.00 2.59
260 262 0.391263 GTGACCGACCCCTTGATGAC 60.391 60.000 0.00 0.0 0.00 3.06
517 525 2.352421 GCCGCTGACTTTGACTGTACTA 60.352 50.000 0.00 0.0 0.00 1.82
1416 1429 2.897969 GAGTCCTCTCACTACCAACCAA 59.102 50.000 0.00 0.0 40.18 3.67
1607 1621 1.006922 CACTGCTGCTGAGTCGTCA 60.007 57.895 13.69 0.0 0.00 4.35
1691 1705 0.973632 TACTGCGCCTTCCTTCTTCA 59.026 50.000 4.18 0.0 0.00 3.02
2042 2057 1.967319 CCCCCTCAATGTGTATTCGG 58.033 55.000 0.00 0.0 0.00 4.30
2241 2256 3.347216 GAGAAGGCTCCAAGCAATAACA 58.653 45.455 0.86 0.0 44.75 2.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.