Multiple sequence alignment - TraesCS2B01G064000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G064000 chr2B 100.000 3161 0 0 1 3161 30537351 30540511 0.000000e+00 5838
1 TraesCS2B01G064000 chr2B 88.582 3109 208 48 4 3064 30544645 30547654 0.000000e+00 3639
2 TraesCS2B01G064000 chr2B 91.323 1164 83 10 2003 3160 30548809 30549960 0.000000e+00 1574
3 TraesCS2B01G064000 chr2B 78.663 1242 198 46 972 2175 30569920 30568708 0.000000e+00 763
4 TraesCS2B01G064000 chr2B 93.130 262 15 2 2901 3161 30547713 30547972 6.400000e-102 381
5 TraesCS2B01G064000 chrUn 97.744 2349 48 3 815 3161 258069257 258066912 0.000000e+00 4039
6 TraesCS2B01G064000 chrUn 97.666 2356 48 5 810 3161 265987871 265990223 0.000000e+00 4039
7 TraesCS2B01G064000 chrUn 97.541 2115 47 3 815 2927 236195595 236193484 0.000000e+00 3613
8 TraesCS2B01G064000 chrUn 90.917 2411 158 34 766 3161 12639923 12637559 0.000000e+00 3182
9 TraesCS2B01G064000 chrUn 90.724 2361 158 34 815 3161 236203172 236200859 0.000000e+00 3090
10 TraesCS2B01G064000 chrUn 93.434 792 25 9 6 794 236203928 236203161 0.000000e+00 1149
11 TraesCS2B01G064000 chrUn 84.088 685 64 21 1 659 12640586 12639921 1.250000e-173 619
12 TraesCS2B01G064000 chr2A 97.581 2356 50 5 810 3161 20039883 20042235 0.000000e+00 4028
13 TraesCS2B01G064000 chr2D 96.992 2360 43 15 810 3161 18736042 18738381 0.000000e+00 3940
14 TraesCS2B01G064000 chr2D 87.557 659 64 11 1 659 18735025 18735665 0.000000e+00 747
15 TraesCS2B01G064000 chr2D 82.689 543 73 14 1721 2246 18750763 18750225 2.220000e-126 462
16 TraesCS2B01G064000 chr2D 89.524 105 6 3 651 753 18735949 18736050 9.200000e-26 128
17 TraesCS2B01G064000 chr6B 76.417 653 122 28 17 654 576367243 576367878 1.090000e-84 324
18 TraesCS2B01G064000 chr4A 76.302 557 87 22 15 533 182892552 182892003 4.050000e-64 255


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G064000 chr2B 30537351 30540511 3160 False 5838.000000 5838 100.000000 1 3161 1 chr2B.!!$F1 3160
1 TraesCS2B01G064000 chr2B 30544645 30549960 5315 False 1864.666667 3639 91.011667 4 3161 3 chr2B.!!$F2 3157
2 TraesCS2B01G064000 chr2B 30568708 30569920 1212 True 763.000000 763 78.663000 972 2175 1 chr2B.!!$R1 1203
3 TraesCS2B01G064000 chrUn 258066912 258069257 2345 True 4039.000000 4039 97.744000 815 3161 1 chrUn.!!$R2 2346
4 TraesCS2B01G064000 chrUn 265987871 265990223 2352 False 4039.000000 4039 97.666000 810 3161 1 chrUn.!!$F1 2351
5 TraesCS2B01G064000 chrUn 236193484 236195595 2111 True 3613.000000 3613 97.541000 815 2927 1 chrUn.!!$R1 2112
6 TraesCS2B01G064000 chrUn 236200859 236203928 3069 True 2119.500000 3090 92.079000 6 3161 2 chrUn.!!$R4 3155
7 TraesCS2B01G064000 chrUn 12637559 12640586 3027 True 1900.500000 3182 87.502500 1 3161 2 chrUn.!!$R3 3160
8 TraesCS2B01G064000 chr2A 20039883 20042235 2352 False 4028.000000 4028 97.581000 810 3161 1 chr2A.!!$F1 2351
9 TraesCS2B01G064000 chr2D 18735025 18738381 3356 False 1605.000000 3940 91.357667 1 3161 3 chr2D.!!$F1 3160
10 TraesCS2B01G064000 chr2D 18750225 18750763 538 True 462.000000 462 82.689000 1721 2246 1 chr2D.!!$R1 525
11 TraesCS2B01G064000 chr6B 576367243 576367878 635 False 324.000000 324 76.417000 17 654 1 chr6B.!!$F1 637
12 TraesCS2B01G064000 chr4A 182892003 182892552 549 True 255.000000 255 76.302000 15 533 1 chr4A.!!$R1 518

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
867 1222 1.349688 ACGCTTCAGTGGACCCATTTA 59.650 47.619 0.0 0.0 0.00 1.40 F
1464 1875 2.266055 CTCCGGCAGGACAGGAAC 59.734 66.667 0.0 0.0 42.55 3.62 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1950 2370 2.507484 CACCAATCACCTTGCTTCTGA 58.493 47.619 0.00 0.0 33.2 3.27 R
2722 5381 2.713863 AACAACAGTTGACCCGGTAA 57.286 45.000 20.56 0.0 0.0 2.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
480 529 9.724839 GTTTTTAAGCTTGTGTCTGTAAATGTA 57.275 29.630 9.86 0.0 0.00 2.29
507 556 2.467880 ACTCCGGTGAACTATGGTGAT 58.532 47.619 11.17 0.0 0.00 3.06
609 660 4.909696 TTGCAGGATTTCTGAAACGAAA 57.090 36.364 4.73 0.0 46.18 3.46
615 666 6.200854 GCAGGATTTCTGAAACGAAAATTTGT 59.799 34.615 4.73 0.0 46.18 2.83
754 1100 2.684881 CAATTCCTTAGGCGCTGATGTT 59.315 45.455 7.64 0.0 0.00 2.71
779 1125 3.791973 TTTTGTTTGCAATGAGGACGT 57.208 38.095 0.00 0.0 34.18 4.34
827 1173 1.963747 GGTGCGTGAGTTTATGCAAC 58.036 50.000 0.00 0.0 43.56 4.17
867 1222 1.349688 ACGCTTCAGTGGACCCATTTA 59.650 47.619 0.00 0.0 0.00 1.40
1396 1807 2.668212 CCTGCGACGGCCTTTTCA 60.668 61.111 0.00 0.0 38.85 2.69
1464 1875 2.266055 CTCCGGCAGGACAGGAAC 59.734 66.667 0.00 0.0 42.55 3.62
1950 2370 1.474077 GTGATGGAAATCAGGCGCTTT 59.526 47.619 7.64 0.0 0.00 3.51
2290 2740 7.317390 GGGAAACGCCTTTAATCATCTTTAAA 58.683 34.615 0.00 0.0 36.66 1.52
2375 2825 6.907212 CGTGGCACTCATATTTTCTATTTGAC 59.093 38.462 16.72 0.0 0.00 3.18
2603 3053 5.730550 TGGTCATCTGTATTGAACCTACAC 58.269 41.667 0.00 0.0 29.40 2.90
2722 5381 3.736252 GCACACGTAGATAAAGATCGCAT 59.264 43.478 0.00 0.0 37.15 4.73
3143 5850 7.999679 ACAATTATGACAATCTATTGGTGTGG 58.000 34.615 7.56 0.0 41.96 4.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
232 256 1.066454 TCTCGTCGAACTTGCTGAACA 59.934 47.619 0.00 0.00 0.00 3.18
480 529 4.443457 CCATAGTTCACCGGAGTTCATCAT 60.443 45.833 9.46 0.00 0.00 2.45
530 579 9.832445 AAAACAGATCCGATATACAAATACTGT 57.168 29.630 0.00 0.00 42.47 3.55
574 625 5.913137 ATCCTGCAAAACGAATTTATGGA 57.087 34.783 0.00 0.00 31.76 3.41
609 660 2.864589 CGCGCGGTACCACAAATT 59.135 55.556 24.84 0.00 0.00 1.82
725 1068 4.777896 AGCGCCTAAGGAATTGAGGATATA 59.222 41.667 2.29 0.00 31.45 0.86
763 1109 3.058293 TCATCAACGTCCTCATTGCAAAC 60.058 43.478 1.71 0.00 0.00 2.93
764 1110 3.145286 TCATCAACGTCCTCATTGCAAA 58.855 40.909 1.71 0.00 0.00 3.68
765 1111 2.743664 CTCATCAACGTCCTCATTGCAA 59.256 45.455 0.00 0.00 0.00 4.08
773 1119 2.254546 TGCAAACTCATCAACGTCCT 57.745 45.000 0.00 0.00 0.00 3.85
777 1123 1.608590 ACCCTTGCAAACTCATCAACG 59.391 47.619 0.00 0.00 0.00 4.10
779 1125 2.665165 ACACCCTTGCAAACTCATCAA 58.335 42.857 0.00 0.00 0.00 2.57
807 1153 1.535462 GTTGCATAAACTCACGCACCT 59.465 47.619 0.00 0.00 35.75 4.00
1396 1807 0.676184 ATGATGTAGCTGCCGACGAT 59.324 50.000 0.00 0.00 0.00 3.73
1464 1875 2.028567 GGCGAAGAGATTCTCTATGGGG 60.029 54.545 16.41 5.96 40.28 4.96
1950 2370 2.507484 CACCAATCACCTTGCTTCTGA 58.493 47.619 0.00 0.00 33.20 3.27
2458 2908 9.337396 ACGATCCAAATTAAGACTAATATTGCA 57.663 29.630 0.00 0.00 0.00 4.08
2722 5381 2.713863 AACAACAGTTGACCCGGTAA 57.286 45.000 20.56 0.00 0.00 2.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.