Multiple sequence alignment - TraesCS2B01G061500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G061500 chr2B 100.000 3441 0 0 1 3441 29348499 29351939 0.000000e+00 6355
1 TraesCS2B01G061500 chr2B 99.419 3442 18 2 1 3441 29262143 29265583 0.000000e+00 6244
2 TraesCS2B01G061500 chr2B 99.390 3442 19 2 1 3441 29317380 29320820 0.000000e+00 6239
3 TraesCS2B01G061500 chr2B 83.388 2426 335 42 116 2516 29548388 29550770 0.000000e+00 2185
4 TraesCS2B01G061500 chr2B 89.332 1528 117 9 742 2234 29218015 29219531 0.000000e+00 1877
5 TraesCS2B01G061500 chr2B 88.243 757 64 9 1 748 29217123 29217863 0.000000e+00 881
6 TraesCS2B01G061500 chr2D 89.885 2432 199 20 1 2409 17776210 17773803 0.000000e+00 3085
7 TraesCS2B01G061500 chr2D 83.553 2432 326 47 116 2516 17613725 17611337 0.000000e+00 2207
8 TraesCS2B01G061500 chr2D 83.381 2431 330 50 116 2516 17641094 17638708 0.000000e+00 2183
9 TraesCS2B01G061500 chr2D 93.730 319 19 1 3124 3441 307811259 307810941 8.640000e-131 477
10 TraesCS2B01G061500 chr2A 83.092 2413 337 48 132 2516 19035916 19033547 0.000000e+00 2130
11 TraesCS2B01G061500 chr2A 89.862 1598 138 10 199 1779 19055659 19054069 0.000000e+00 2032
12 TraesCS2B01G061500 chr2A 87.469 1205 106 21 1744 2927 19054070 19052890 0.000000e+00 1347
13 TraesCS2B01G061500 chr2A 93.691 317 20 0 3125 3441 620205415 620205099 3.110000e-130 475
14 TraesCS2B01G061500 chr2A 90.500 200 19 0 1 200 19056006 19055807 7.320000e-67 265
15 TraesCS2B01G061500 chr3B 82.615 1438 206 30 1092 2516 765017783 765019189 0.000000e+00 1230
16 TraesCS2B01G061500 chr7B 88.903 775 51 14 1923 2680 745128183 745128939 0.000000e+00 922
17 TraesCS2B01G061500 chr1D 94.375 320 18 0 3122 3441 285438580 285438261 3.090000e-135 492
18 TraesCS2B01G061500 chr1D 94.340 318 18 0 3124 3441 296294406 296294089 3.990000e-134 488
19 TraesCS2B01G061500 chr4B 94.006 317 19 0 3125 3441 247542586 247542270 6.680000e-132 481
20 TraesCS2B01G061500 chr6D 93.711 318 19 1 3124 3441 268054787 268055103 3.110000e-130 475
21 TraesCS2B01G061500 chr3D 93.458 321 20 1 3122 3441 250860386 250860066 3.110000e-130 475


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G061500 chr2B 29348499 29351939 3440 False 6355.000000 6355 100.0000 1 3441 1 chr2B.!!$F3 3440
1 TraesCS2B01G061500 chr2B 29262143 29265583 3440 False 6244.000000 6244 99.4190 1 3441 1 chr2B.!!$F1 3440
2 TraesCS2B01G061500 chr2B 29317380 29320820 3440 False 6239.000000 6239 99.3900 1 3441 1 chr2B.!!$F2 3440
3 TraesCS2B01G061500 chr2B 29548388 29550770 2382 False 2185.000000 2185 83.3880 116 2516 1 chr2B.!!$F4 2400
4 TraesCS2B01G061500 chr2B 29217123 29219531 2408 False 1379.000000 1877 88.7875 1 2234 2 chr2B.!!$F5 2233
5 TraesCS2B01G061500 chr2D 17773803 17776210 2407 True 3085.000000 3085 89.8850 1 2409 1 chr2D.!!$R3 2408
6 TraesCS2B01G061500 chr2D 17611337 17613725 2388 True 2207.000000 2207 83.5530 116 2516 1 chr2D.!!$R1 2400
7 TraesCS2B01G061500 chr2D 17638708 17641094 2386 True 2183.000000 2183 83.3810 116 2516 1 chr2D.!!$R2 2400
8 TraesCS2B01G061500 chr2A 19033547 19035916 2369 True 2130.000000 2130 83.0920 132 2516 1 chr2A.!!$R1 2384
9 TraesCS2B01G061500 chr2A 19052890 19056006 3116 True 1214.666667 2032 89.2770 1 2927 3 chr2A.!!$R3 2926
10 TraesCS2B01G061500 chr3B 765017783 765019189 1406 False 1230.000000 1230 82.6150 1092 2516 1 chr3B.!!$F1 1424
11 TraesCS2B01G061500 chr7B 745128183 745128939 756 False 922.000000 922 88.9030 1923 2680 1 chr7B.!!$F1 757

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
997 1329 7.905604 TGTCATGTTATACCTTGAGTCTTTG 57.094 36.000 0.00 0.00 0.00 2.77 F
1036 1368 5.376854 GGTAACTACTCCGAGTGTTACAA 57.623 43.478 30.03 13.33 40.41 2.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1919 2328 2.213499 CCAACAGTGTTTCTCTTCGCT 58.787 47.619 5.57 0.0 0.0 4.93 R
2955 3386 2.816411 ACAAGGGAGAGACGGAATACA 58.184 47.619 0.00 0.0 0.0 2.29 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
997 1329 7.905604 TGTCATGTTATACCTTGAGTCTTTG 57.094 36.000 0.00 0.00 0.00 2.77
1036 1368 5.376854 GGTAACTACTCCGAGTGTTACAA 57.623 43.478 30.03 13.33 40.41 2.41
1350 1716 9.462174 CATGTGTTTTACTTAATTGTGTGTCAT 57.538 29.630 0.00 0.00 0.00 3.06
2717 3148 5.221461 ACCGACAATCTCTGTAAACTGAACT 60.221 40.000 0.00 0.00 38.84 3.01
2892 3323 5.263599 TGCACCACTAATTCTTCATCCAAT 58.736 37.500 0.00 0.00 0.00 3.16
2955 3386 1.972588 AACCTAGTCATGGGGCTCTT 58.027 50.000 0.00 0.00 0.00 2.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1015 1347 6.442112 AGTTTGTAACACTCGGAGTAGTTAC 58.558 40.000 30.71 30.71 39.84 2.50
1036 1368 0.825010 CAACTCCCTGCTGGCAAGTT 60.825 55.000 17.44 17.44 37.92 2.66
1891 2300 5.036916 TCCCTCTGGATTAGGTAACACAAT 58.963 41.667 0.00 0.00 35.03 2.71
1919 2328 2.213499 CCAACAGTGTTTCTCTTCGCT 58.787 47.619 5.57 0.00 0.00 4.93
2132 2541 6.263617 TGGTAGTGGTAGTTTCAACATTTTCC 59.736 38.462 0.00 0.00 0.00 3.13
2917 3348 5.915175 AGGTTTCGTTAGAAAAGAGACACT 58.085 37.500 0.00 0.00 46.63 3.55
2955 3386 2.816411 ACAAGGGAGAGACGGAATACA 58.184 47.619 0.00 0.00 0.00 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.