Multiple sequence alignment - TraesCS2B01G056000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G056000 chr2B 100.000 3725 0 0 1 3725 27354833 27358557 0.000000e+00 6879
1 TraesCS2B01G056000 chr2B 98.821 3733 36 1 1 3725 27286518 27290250 0.000000e+00 6643
2 TraesCS2B01G056000 chr2B 98.687 3733 40 7 1 3725 27248925 27252656 0.000000e+00 6613
3 TraesCS2B01G056000 chr2B 98.547 3097 36 4 629 3725 27406510 27409597 0.000000e+00 5461
4 TraesCS2B01G056000 chr2B 90.427 679 32 4 1 647 27405808 27406485 0.000000e+00 863
5 TraesCS2B01G056000 chr2B 91.568 593 32 2 2 576 788303422 788302830 0.000000e+00 802
6 TraesCS2B01G056000 chr2B 89.231 585 49 8 1 571 451905941 451905357 0.000000e+00 719
7 TraesCS2B01G056000 chr2B 79.949 394 57 19 197 576 411522955 411523340 1.710000e-68 270
8 TraesCS2B01G056000 chr2D 94.438 1834 78 13 1165 2985 15264558 15266380 0.000000e+00 2800
9 TraesCS2B01G056000 chr2D 94.384 1834 79 13 1165 2985 15228847 15230669 0.000000e+00 2795
10 TraesCS2B01G056000 chr2D 90.750 400 25 7 770 1164 15228512 15228904 1.190000e-144 523
11 TraesCS2B01G056000 chr2D 90.500 400 26 7 770 1164 15249315 15249707 5.510000e-143 518
12 TraesCS2B01G056000 chr2D 90.500 400 26 7 770 1164 15264223 15264615 5.510000e-143 518
13 TraesCS2B01G056000 chr2D 95.588 272 12 0 3240 3511 15334800 15335071 1.590000e-118 436
14 TraesCS2B01G056000 chr2D 82.110 218 15 13 575 768 15228249 15228466 8.280000e-37 165
15 TraesCS2B01G056000 chr2D 82.110 218 15 13 575 768 15249052 15249269 8.280000e-37 165
16 TraesCS2B01G056000 chr2D 82.110 218 15 13 575 768 15263960 15264177 8.280000e-37 165
17 TraesCS2B01G056000 chr2D 87.248 149 10 5 629 768 19849645 19849497 1.070000e-35 161
18 TraesCS2B01G056000 chrUn 94.265 1831 81 13 1168 2985 266171078 266169259 0.000000e+00 2778
19 TraesCS2B01G056000 chrUn 90.750 400 25 7 770 1164 266171416 266171024 1.190000e-144 523
20 TraesCS2B01G056000 chrUn 93.538 325 15 4 770 1090 375769996 375769674 2.600000e-131 479
21 TraesCS2B01G056000 chrUn 81.651 218 16 13 575 768 266171679 266171462 3.850000e-35 159
22 TraesCS2B01G056000 chrUn 81.651 218 16 13 575 768 375770259 375770042 3.850000e-35 159
23 TraesCS2B01G056000 chr2A 92.382 1969 96 30 1222 3147 17300277 17302234 0.000000e+00 2756
24 TraesCS2B01G056000 chr2A 81.122 588 90 9 5 575 290198077 290197494 5.670000e-123 451
25 TraesCS2B01G056000 chr2A 91.743 327 21 5 771 1093 20365241 20365565 2.040000e-122 449
26 TraesCS2B01G056000 chr2A 95.946 74 3 0 575 648 17299609 17299682 1.820000e-23 121
27 TraesCS2B01G056000 chr7B 92.029 1769 125 13 1222 2985 70069414 70071171 0.000000e+00 2471
28 TraesCS2B01G056000 chr7B 92.025 1768 126 13 1222 2985 69849759 69851515 0.000000e+00 2470
29 TraesCS2B01G056000 chr7B 88.345 592 53 8 1 576 24398118 24398709 0.000000e+00 697
30 TraesCS2B01G056000 chr7B 92.593 162 12 0 2981 3142 69994701 69994862 2.240000e-57 233
31 TraesCS2B01G056000 chr7B 91.975 162 13 0 2981 3142 70071200 70071361 1.040000e-55 228
32 TraesCS2B01G056000 chr6B 88.215 594 51 10 1 576 38019971 38019379 0.000000e+00 691
33 TraesCS2B01G056000 chr6B 91.975 162 13 0 2981 3142 548950596 548950757 1.040000e-55 228
34 TraesCS2B01G056000 chr6B 91.975 162 13 0 2981 3142 549031109 549031270 1.040000e-55 228
35 TraesCS2B01G056000 chr3B 86.242 596 62 9 1 576 744656410 744655815 2.440000e-176 628
36 TraesCS2B01G056000 chr4B 84.175 594 71 15 1 576 53025479 53024891 4.200000e-154 555
37 TraesCS2B01G056000 chr6A 83.859 539 65 17 51 575 113536704 113536174 9.290000e-136 494
38 TraesCS2B01G056000 chr7D 81.879 596 83 19 1 576 445306708 445307298 2.600000e-131 479
39 TraesCS2B01G056000 chr5B 81.711 596 79 19 1 580 302839396 302838815 1.570000e-128 470
40 TraesCS2B01G056000 chr7A 92.216 167 11 1 2981 3147 116020789 116020953 6.220000e-58 235


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G056000 chr2B 27354833 27358557 3724 False 6879.000000 6879 100.000000 1 3725 1 chr2B.!!$F3 3724
1 TraesCS2B01G056000 chr2B 27286518 27290250 3732 False 6643.000000 6643 98.821000 1 3725 1 chr2B.!!$F2 3724
2 TraesCS2B01G056000 chr2B 27248925 27252656 3731 False 6613.000000 6613 98.687000 1 3725 1 chr2B.!!$F1 3724
3 TraesCS2B01G056000 chr2B 27405808 27409597 3789 False 3162.000000 5461 94.487000 1 3725 2 chr2B.!!$F5 3724
4 TraesCS2B01G056000 chr2B 788302830 788303422 592 True 802.000000 802 91.568000 2 576 1 chr2B.!!$R2 574
5 TraesCS2B01G056000 chr2B 451905357 451905941 584 True 719.000000 719 89.231000 1 571 1 chr2B.!!$R1 570
6 TraesCS2B01G056000 chr2D 15228249 15230669 2420 False 1161.000000 2795 89.081333 575 2985 3 chr2D.!!$F2 2410
7 TraesCS2B01G056000 chr2D 15263960 15266380 2420 False 1161.000000 2800 89.016000 575 2985 3 chr2D.!!$F4 2410
8 TraesCS2B01G056000 chr2D 15249052 15249707 655 False 341.500000 518 86.305000 575 1164 2 chr2D.!!$F3 589
9 TraesCS2B01G056000 chrUn 266169259 266171679 2420 True 1153.333333 2778 88.888667 575 2985 3 chrUn.!!$R1 2410
10 TraesCS2B01G056000 chrUn 375769674 375770259 585 True 319.000000 479 87.594500 575 1090 2 chrUn.!!$R2 515
11 TraesCS2B01G056000 chr2A 17299609 17302234 2625 False 1438.500000 2756 94.164000 575 3147 2 chr2A.!!$F2 2572
12 TraesCS2B01G056000 chr2A 290197494 290198077 583 True 451.000000 451 81.122000 5 575 1 chr2A.!!$R1 570
13 TraesCS2B01G056000 chr7B 69849759 69851515 1756 False 2470.000000 2470 92.025000 1222 2985 1 chr7B.!!$F2 1763
14 TraesCS2B01G056000 chr7B 70069414 70071361 1947 False 1349.500000 2471 92.002000 1222 3142 2 chr7B.!!$F4 1920
15 TraesCS2B01G056000 chr7B 24398118 24398709 591 False 697.000000 697 88.345000 1 576 1 chr7B.!!$F1 575
16 TraesCS2B01G056000 chr6B 38019379 38019971 592 True 691.000000 691 88.215000 1 576 1 chr6B.!!$R1 575
17 TraesCS2B01G056000 chr3B 744655815 744656410 595 True 628.000000 628 86.242000 1 576 1 chr3B.!!$R1 575
18 TraesCS2B01G056000 chr4B 53024891 53025479 588 True 555.000000 555 84.175000 1 576 1 chr4B.!!$R1 575
19 TraesCS2B01G056000 chr6A 113536174 113536704 530 True 494.000000 494 83.859000 51 575 1 chr6A.!!$R1 524
20 TraesCS2B01G056000 chr7D 445306708 445307298 590 False 479.000000 479 81.879000 1 576 1 chr7D.!!$F1 575
21 TraesCS2B01G056000 chr5B 302838815 302839396 581 True 470.000000 470 81.711000 1 580 1 chr5B.!!$R1 579

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
526 596 0.528466 AGTCCATGTATGTGCGCTCG 60.528 55.0 9.73 0.0 0.0 5.03 F
1183 1393 3.288964 GGATTGTCTCGTCTCCCTCTTA 58.711 50.0 0.00 0.0 0.0 2.10 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1601 1833 2.780643 CATCTTCCACTGCACGCG 59.219 61.111 3.53 3.53 0.00 6.01 R
3062 3335 1.630878 TGCCCTTTGGGTGTTTTTGTT 59.369 42.857 4.42 0.00 46.51 2.83 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
505 575 0.749818 TTGGGTGTGTGCGTGTGAAT 60.750 50.000 0.00 0.0 0.00 2.57
526 596 0.528466 AGTCCATGTATGTGCGCTCG 60.528 55.000 9.73 0.0 0.00 5.03
1183 1393 3.288964 GGATTGTCTCGTCTCCCTCTTA 58.711 50.000 0.00 0.0 0.00 2.10
1601 1833 4.430765 GCCATGTGCCTGTGCTGC 62.431 66.667 0.00 0.0 38.71 5.25
2258 2490 2.477375 CGCTTTAACCAACTTACGAGCA 59.523 45.455 0.00 0.0 0.00 4.26
3062 3335 5.451798 GGCAAGGTCATCTTTTGTTTTCTGA 60.452 40.000 0.00 0.0 32.41 3.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
13 14 5.414360 CAGGAGAAGAAGATGTGATTCGAA 58.586 41.667 0.00 0.00 0.00 3.71
505 575 2.798145 CGAGCGCACATACATGGACTAA 60.798 50.000 11.47 0.00 0.00 2.24
526 596 8.104222 CTTTATAAATAAAGCAAACCGTCAGC 57.896 34.615 9.01 0.00 41.69 4.26
1183 1393 7.451877 ACCACCTTCGATGTATACAGATTAGAT 59.548 37.037 11.91 0.00 0.00 1.98
1601 1833 2.780643 CATCTTCCACTGCACGCG 59.219 61.111 3.53 3.53 0.00 6.01
2464 2698 7.176690 TGGGTTTGAGACTTCTTATTTCCAATC 59.823 37.037 0.00 0.00 0.00 2.67
3037 3308 4.405358 AGAAAACAAAAGATGACCTTGCCA 59.595 37.500 0.00 0.00 34.79 4.92
3062 3335 1.630878 TGCCCTTTGGGTGTTTTTGTT 59.369 42.857 4.42 0.00 46.51 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.