Multiple sequence alignment - TraesCS2B01G055800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G055800 chr2B 100.000 4461 0 0 1 4461 27248819 27253279 0.000000e+00 8239
1 TraesCS2B01G055800 chr2B 99.485 4462 21 2 1 4461 27286412 27290872 0.000000e+00 8111
2 TraesCS2B01G055800 chr2B 98.812 4463 43 8 1 4461 27354727 27359181 0.000000e+00 7939
3 TraesCS2B01G055800 chr2B 98.171 3390 48 5 742 4131 27406510 27409885 0.000000e+00 5904
4 TraesCS2B01G055800 chr2B 92.347 784 34 9 2 760 27405703 27406485 0.000000e+00 1092
5 TraesCS2B01G055800 chr2B 92.482 705 36 4 1 689 788303533 788302830 0.000000e+00 992
6 TraesCS2B01G055800 chr2B 92.330 704 39 4 1 689 788412835 788413538 0.000000e+00 987
7 TraesCS2B01G055800 chr2B 92.188 704 40 4 1 689 788382477 788383180 0.000000e+00 981
8 TraesCS2B01G055800 chr2B 90.738 691 56 5 1 684 451906046 451905357 0.000000e+00 915
9 TraesCS2B01G055800 chr2B 96.386 332 8 4 4132 4461 27410641 27410970 1.090000e-150 544
10 TraesCS2B01G055800 chr2B 80.711 394 62 13 302 689 411522955 411523340 1.210000e-75 294
11 TraesCS2B01G055800 chr2D 92.836 2010 83 30 1278 3240 15228847 15230842 0.000000e+00 2857
12 TraesCS2B01G055800 chr2D 92.836 2010 83 30 1278 3240 15264558 15266553 0.000000e+00 2857
13 TraesCS2B01G055800 chr2D 94.290 1366 57 9 1278 2632 15249650 15251005 0.000000e+00 2071
14 TraesCS2B01G055800 chr2D 90.250 400 27 7 883 1277 15228512 15228904 3.080000e-141 512
15 TraesCS2B01G055800 chr2D 90.000 400 28 7 883 1277 15249315 15249707 1.430000e-139 507
16 TraesCS2B01G055800 chr2D 90.000 400 28 7 883 1277 15264223 15264615 1.430000e-139 507
17 TraesCS2B01G055800 chr2D 94.118 272 16 0 3353 3624 15334800 15335071 8.930000e-112 414
18 TraesCS2B01G055800 chr2D 82.569 218 14 13 688 881 15228249 15228466 2.130000e-38 171
19 TraesCS2B01G055800 chr2D 82.569 218 14 13 688 881 15249052 15249269 2.130000e-38 171
20 TraesCS2B01G055800 chr2D 82.569 218 14 13 688 881 15263960 15264177 2.130000e-38 171
21 TraesCS2B01G055800 chr2D 87.248 149 10 5 742 881 19849645 19849497 1.280000e-35 161
22 TraesCS2B01G055800 chrUn 92.725 2007 85 30 1281 3240 266171078 266169086 0.000000e+00 2841
23 TraesCS2B01G055800 chrUn 92.288 1569 72 26 1708 3240 379234394 379232839 0.000000e+00 2182
24 TraesCS2B01G055800 chrUn 91.845 699 45 3 1 687 272921456 272920758 0.000000e+00 965
25 TraesCS2B01G055800 chrUn 90.250 400 27 7 883 1277 266171416 266171024 3.080000e-141 512
26 TraesCS2B01G055800 chrUn 92.923 325 17 4 883 1203 375769996 375769674 6.760000e-128 468
27 TraesCS2B01G055800 chrUn 82.110 218 15 13 688 881 266171679 266171462 9.930000e-37 165
28 TraesCS2B01G055800 chrUn 82.110 218 15 13 688 881 375770259 375770042 9.930000e-37 165
29 TraesCS2B01G055800 chr2A 92.179 1969 100 28 1335 3260 17300277 17302234 0.000000e+00 2734
30 TraesCS2B01G055800 chr2A 91.131 327 23 5 884 1206 20365241 20365565 5.300000e-119 438
31 TraesCS2B01G055800 chr7B 90.264 1777 148 16 1335 3098 70339888 70341652 0.000000e+00 2300
32 TraesCS2B01G055800 chr7B 86.397 691 90 4 1 689 690266489 690267177 0.000000e+00 752
33 TraesCS2B01G055800 chr7B 82.927 697 109 8 1 689 427880298 427880992 1.760000e-173 619
34 TraesCS2B01G055800 chr7B 92.593 162 12 0 3094 3255 69994701 69994862 2.680000e-57 233
35 TraesCS2B01G055800 chr7B 91.975 162 13 0 3094 3255 70071200 70071361 1.250000e-55 228
36 TraesCS2B01G055800 chr6B 91.954 696 44 3 1 684 51944075 51944770 0.000000e+00 965
37 TraesCS2B01G055800 chr6B 91.975 162 13 0 3094 3255 548950596 548950757 1.250000e-55 228
38 TraesCS2B01G055800 chr6B 91.975 162 13 0 3094 3255 549031109 549031270 1.250000e-55 228
39 TraesCS2B01G055800 chr4B 90.671 686 60 4 2 685 339492277 339492960 0.000000e+00 909
40 TraesCS2B01G055800 chr7D 82.906 702 102 15 1 689 445306602 445307298 2.280000e-172 616
41 TraesCS2B01G055800 chr1B 80.375 693 120 13 4 684 157747143 157747831 3.080000e-141 512
42 TraesCS2B01G055800 chr7A 83.205 518 60 16 1377 1892 692056337 692055845 2.450000e-122 449
43 TraesCS2B01G055800 chr7A 91.617 167 12 1 3094 3260 116020789 116020953 3.470000e-56 230


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G055800 chr2B 27248819 27253279 4460 False 8239.000000 8239 100.000000 1 4461 1 chr2B.!!$F1 4460
1 TraesCS2B01G055800 chr2B 27286412 27290872 4460 False 8111.000000 8111 99.485000 1 4461 1 chr2B.!!$F2 4460
2 TraesCS2B01G055800 chr2B 27354727 27359181 4454 False 7939.000000 7939 98.812000 1 4461 1 chr2B.!!$F3 4460
3 TraesCS2B01G055800 chr2B 27405703 27410970 5267 False 2513.333333 5904 95.634667 2 4461 3 chr2B.!!$F7 4459
4 TraesCS2B01G055800 chr2B 788302830 788303533 703 True 992.000000 992 92.482000 1 689 1 chr2B.!!$R2 688
5 TraesCS2B01G055800 chr2B 788412835 788413538 703 False 987.000000 987 92.330000 1 689 1 chr2B.!!$F6 688
6 TraesCS2B01G055800 chr2B 788382477 788383180 703 False 981.000000 981 92.188000 1 689 1 chr2B.!!$F5 688
7 TraesCS2B01G055800 chr2B 451905357 451906046 689 True 915.000000 915 90.738000 1 684 1 chr2B.!!$R1 683
8 TraesCS2B01G055800 chr2D 15228249 15230842 2593 False 1180.000000 2857 88.551667 688 3240 3 chr2D.!!$F2 2552
9 TraesCS2B01G055800 chr2D 15263960 15266553 2593 False 1178.333333 2857 88.468333 688 3240 3 chr2D.!!$F4 2552
10 TraesCS2B01G055800 chr2D 15249052 15251005 1953 False 916.333333 2071 88.953000 688 2632 3 chr2D.!!$F3 1944
11 TraesCS2B01G055800 chrUn 379232839 379234394 1555 True 2182.000000 2182 92.288000 1708 3240 1 chrUn.!!$R2 1532
12 TraesCS2B01G055800 chrUn 266169086 266171679 2593 True 1172.666667 2841 88.361667 688 3240 3 chrUn.!!$R3 2552
13 TraesCS2B01G055800 chrUn 272920758 272921456 698 True 965.000000 965 91.845000 1 687 1 chrUn.!!$R1 686
14 TraesCS2B01G055800 chrUn 375769674 375770259 585 True 316.500000 468 87.516500 688 1203 2 chrUn.!!$R4 515
15 TraesCS2B01G055800 chr2A 17300277 17302234 1957 False 2734.000000 2734 92.179000 1335 3260 1 chr2A.!!$F1 1925
16 TraesCS2B01G055800 chr7B 70339888 70341652 1764 False 2300.000000 2300 90.264000 1335 3098 1 chr7B.!!$F3 1763
17 TraesCS2B01G055800 chr7B 690266489 690267177 688 False 752.000000 752 86.397000 1 689 1 chr7B.!!$F5 688
18 TraesCS2B01G055800 chr7B 427880298 427880992 694 False 619.000000 619 82.927000 1 689 1 chr7B.!!$F4 688
19 TraesCS2B01G055800 chr6B 51944075 51944770 695 False 965.000000 965 91.954000 1 684 1 chr6B.!!$F1 683
20 TraesCS2B01G055800 chr4B 339492277 339492960 683 False 909.000000 909 90.671000 2 685 1 chr4B.!!$F1 683
21 TraesCS2B01G055800 chr7D 445306602 445307298 696 False 616.000000 616 82.906000 1 689 1 chr7D.!!$F1 688
22 TraesCS2B01G055800 chr1B 157747143 157747831 688 False 512.000000 512 80.375000 4 684 1 chr1B.!!$F1 680

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
429 440 0.029567 CTAGACCACGACGCCATCTC 59.970 60.0 0.0 0.0 0.0 2.75 F
430 441 1.381928 TAGACCACGACGCCATCTCC 61.382 60.0 0.0 0.0 0.0 3.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1624 1798 0.554305 TACAGTAGGCCGGATGAGGA 59.446 55.000 5.05 0.0 0.0 3.71 R
3551 3781 1.134759 TCGTTTGTTGTCGGTCTTGGA 60.135 47.619 0.00 0.0 0.0 3.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
393 404 0.104671 GGTTTCTTGCAGCTTTGGCA 59.895 50.000 0.00 0.00 41.70 4.92
412 423 4.892291 CCCCTTAGCCGCCCCCTA 62.892 72.222 0.00 0.00 0.00 3.53
417 428 3.320411 TTAGCCGCCCCCTAGACCA 62.320 63.158 0.00 0.00 0.00 4.02
424 435 3.834799 CCCCTAGACCACGACGCC 61.835 72.222 0.00 0.00 0.00 5.68
425 436 3.066190 CCCTAGACCACGACGCCA 61.066 66.667 0.00 0.00 0.00 5.69
426 437 2.423898 CCCTAGACCACGACGCCAT 61.424 63.158 0.00 0.00 0.00 4.40
427 438 1.065928 CCTAGACCACGACGCCATC 59.934 63.158 0.00 0.00 0.00 3.51
428 439 1.384989 CCTAGACCACGACGCCATCT 61.385 60.000 0.00 0.00 0.00 2.90
429 440 0.029567 CTAGACCACGACGCCATCTC 59.970 60.000 0.00 0.00 0.00 2.75
430 441 1.381928 TAGACCACGACGCCATCTCC 61.382 60.000 0.00 0.00 0.00 3.71
431 442 4.129737 ACCACGACGCCATCTCCG 62.130 66.667 0.00 0.00 0.00 4.63
1131 1290 3.229156 ATGGTTTCCGCCGACGTGA 62.229 57.895 0.00 0.00 37.70 4.35
1624 1798 0.034089 GTGCAACCCTCCTAATGCCT 60.034 55.000 0.00 0.00 38.00 4.75
3551 3781 0.037590 TAAACAGCCGCAGAACCCAT 59.962 50.000 0.00 0.00 0.00 4.00
3984 4214 1.136000 TGAGCATCATTTCGCGTGTTG 60.136 47.619 5.77 3.89 42.56 3.33
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
397 408 2.122989 TCTAGGGGGCGGCTAAGG 60.123 66.667 9.56 0.0 0.00 2.69
412 423 2.711922 GGAGATGGCGTCGTGGTCT 61.712 63.158 0.13 0.0 0.00 3.85
424 435 0.877649 CGGTGATGAAGGCGGAGATG 60.878 60.000 0.00 0.0 0.00 2.90
425 436 1.043116 TCGGTGATGAAGGCGGAGAT 61.043 55.000 0.00 0.0 0.00 2.75
426 437 1.680989 TCGGTGATGAAGGCGGAGA 60.681 57.895 0.00 0.0 0.00 3.71
427 438 1.519455 GTCGGTGATGAAGGCGGAG 60.519 63.158 0.00 0.0 0.00 4.63
428 439 2.577059 GTCGGTGATGAAGGCGGA 59.423 61.111 0.00 0.0 0.00 5.54
429 440 2.511600 GGTCGGTGATGAAGGCGG 60.512 66.667 0.00 0.0 0.00 6.13
430 441 1.519455 GAGGTCGGTGATGAAGGCG 60.519 63.158 0.00 0.0 0.00 5.52
431 442 1.153349 GGAGGTCGGTGATGAAGGC 60.153 63.158 0.00 0.0 0.00 4.35
896 1051 2.168728 GCAGTCCTTATCGAACTCCCTT 59.831 50.000 0.00 0.0 0.00 3.95
1131 1290 4.446413 GCCGACGATGTTCCGGGT 62.446 66.667 0.00 0.0 43.17 5.28
1624 1798 0.554305 TACAGTAGGCCGGATGAGGA 59.446 55.000 5.05 0.0 0.00 3.71
3551 3781 1.134759 TCGTTTGTTGTCGGTCTTGGA 60.135 47.619 0.00 0.0 0.00 3.53
3599 3829 1.604278 GACCAGTTGTGAGGTGCTTTC 59.396 52.381 0.00 0.0 38.50 2.62
3984 4214 2.099263 TGCAGTTCCGCAGACTATCTAC 59.901 50.000 0.00 0.0 36.86 2.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.