Multiple sequence alignment - TraesCS2B01G049500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G049500 chr2B 100.000 2518 0 0 1 2518 24656929 24659446 0 4650
1 TraesCS2B01G049500 chr2B 95.265 1753 72 9 1 1746 43436472 43434724 0 2767
2 TraesCS2B01G049500 chr2B 97.301 778 13 3 1741 2515 24665517 24666289 0 1314
3 TraesCS2B01G049500 chr2B 96.287 781 24 4 1741 2518 200948122 200947344 0 1277
4 TraesCS2B01G049500 chr2B 95.903 781 22 5 1741 2518 104854490 104853717 0 1256
5 TraesCS2B01G049500 chr7B 96.514 1750 53 6 1 1746 412108929 412107184 0 2887
6 TraesCS2B01G049500 chr7B 94.575 1751 83 9 1 1746 527888393 527890136 0 2697
7 TraesCS2B01G049500 chr7B 95.536 784 27 6 1739 2518 437875970 437876749 0 1247
8 TraesCS2B01G049500 chr5B 95.995 1748 65 4 1 1746 291234738 291236482 0 2835
9 TraesCS2B01G049500 chr5B 95.029 1750 79 7 1 1746 529134669 529136414 0 2743
10 TraesCS2B01G049500 chr4B 95.941 1749 63 6 1 1746 139085771 139084028 0 2830
11 TraesCS2B01G049500 chr4B 95.886 1750 57 8 1 1746 27775298 27773560 0 2819
12 TraesCS2B01G049500 chr4B 96.149 779 19 5 1741 2515 324215530 324216301 0 1262
13 TraesCS2B01G049500 chr3B 95.543 1750 71 6 1 1746 306806169 306807915 0 2793
14 TraesCS2B01G049500 chr3B 95.691 789 23 6 1735 2518 683001126 683001908 0 1258
15 TraesCS2B01G049500 chr3B 95.663 784 25 6 1741 2518 53797516 53798296 0 1251
16 TraesCS2B01G049500 chr3B 95.769 780 25 4 1741 2518 319080777 319080004 0 1251
17 TraesCS2B01G049500 chr1B 94.400 1750 78 14 7 1746 67107583 67105844 0 2671
18 TraesCS2B01G049500 chr1B 95.541 785 26 6 1741 2518 330112389 330111607 0 1247


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G049500 chr2B 24656929 24659446 2517 False 4650 4650 100.000 1 2518 1 chr2B.!!$F1 2517
1 TraesCS2B01G049500 chr2B 43434724 43436472 1748 True 2767 2767 95.265 1 1746 1 chr2B.!!$R1 1745
2 TraesCS2B01G049500 chr2B 24665517 24666289 772 False 1314 1314 97.301 1741 2515 1 chr2B.!!$F2 774
3 TraesCS2B01G049500 chr2B 200947344 200948122 778 True 1277 1277 96.287 1741 2518 1 chr2B.!!$R3 777
4 TraesCS2B01G049500 chr2B 104853717 104854490 773 True 1256 1256 95.903 1741 2518 1 chr2B.!!$R2 777
5 TraesCS2B01G049500 chr7B 412107184 412108929 1745 True 2887 2887 96.514 1 1746 1 chr7B.!!$R1 1745
6 TraesCS2B01G049500 chr7B 527888393 527890136 1743 False 2697 2697 94.575 1 1746 1 chr7B.!!$F2 1745
7 TraesCS2B01G049500 chr7B 437875970 437876749 779 False 1247 1247 95.536 1739 2518 1 chr7B.!!$F1 779
8 TraesCS2B01G049500 chr5B 291234738 291236482 1744 False 2835 2835 95.995 1 1746 1 chr5B.!!$F1 1745
9 TraesCS2B01G049500 chr5B 529134669 529136414 1745 False 2743 2743 95.029 1 1746 1 chr5B.!!$F2 1745
10 TraesCS2B01G049500 chr4B 139084028 139085771 1743 True 2830 2830 95.941 1 1746 1 chr4B.!!$R2 1745
11 TraesCS2B01G049500 chr4B 27773560 27775298 1738 True 2819 2819 95.886 1 1746 1 chr4B.!!$R1 1745
12 TraesCS2B01G049500 chr4B 324215530 324216301 771 False 1262 1262 96.149 1741 2515 1 chr4B.!!$F1 774
13 TraesCS2B01G049500 chr3B 306806169 306807915 1746 False 2793 2793 95.543 1 1746 1 chr3B.!!$F2 1745
14 TraesCS2B01G049500 chr3B 683001126 683001908 782 False 1258 1258 95.691 1735 2518 1 chr3B.!!$F3 783
15 TraesCS2B01G049500 chr3B 53797516 53798296 780 False 1251 1251 95.663 1741 2518 1 chr3B.!!$F1 777
16 TraesCS2B01G049500 chr3B 319080004 319080777 773 True 1251 1251 95.769 1741 2518 1 chr3B.!!$R1 777
17 TraesCS2B01G049500 chr1B 67105844 67107583 1739 True 2671 2671 94.400 7 1746 1 chr1B.!!$R1 1739
18 TraesCS2B01G049500 chr1B 330111607 330112389 782 True 1247 1247 95.541 1741 2518 1 chr1B.!!$R2 777

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
562 574 0.17902 ATATGGATGTGTGTGCCGGG 60.179 55.0 2.18 0.0 0.0 5.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2017 2044 0.461548 ATCATCATCGTCACCACGCT 59.538 50.0 0.0 0.0 46.28 5.07 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
41 42 2.027837 GCAAGGCCAATCAAGTTCCAAT 60.028 45.455 5.01 0.00 0.00 3.16
176 177 2.290960 GGCAACTAAGGAACAGACCCAT 60.291 50.000 0.00 0.00 0.00 4.00
562 574 0.179020 ATATGGATGTGTGTGCCGGG 60.179 55.000 2.18 0.00 0.00 5.73
709 725 3.118811 TCCTTCCCTGTTTGCACTTTTTG 60.119 43.478 0.00 0.00 0.00 2.44
807 823 6.293027 CCATGCAAACTGACTTTTTGATTTCC 60.293 38.462 0.00 0.00 36.24 3.13
905 922 0.479378 TTTCAACTACCCCCACCCAC 59.521 55.000 0.00 0.00 0.00 4.61
1113 1131 4.171754 GCTTTGAGGTGCTTGATTCAATC 58.828 43.478 0.00 0.00 30.45 2.67
1386 1409 0.033504 TTGCGAGTTCACCTGACTCC 59.966 55.000 0.00 0.00 0.00 3.85
1463 1488 0.616679 AAGGTAGACTTGCCCCGCTA 60.617 55.000 0.00 0.00 38.21 4.26
1497 1522 1.531578 GGTCGTTGAGCTCCAGAAAAC 59.468 52.381 12.15 7.52 0.00 2.43
1498 1523 2.210116 GTCGTTGAGCTCCAGAAAACA 58.790 47.619 12.15 0.00 0.00 2.83
1536 1561 6.183360 TGGTTGACGAATGAAGATTTCAACAA 60.183 34.615 12.80 0.68 43.95 2.83
1537 1562 6.863126 GGTTGACGAATGAAGATTTCAACAAT 59.137 34.615 12.80 0.00 43.95 2.71
1600 1625 5.241662 AGAAAGTCATCAAGAGGTACAAGC 58.758 41.667 0.00 0.00 0.00 4.01
1818 1844 1.227674 GCATAGCAACGAGAGGGGG 60.228 63.158 0.00 0.00 0.00 5.40
2017 2044 0.176910 TGAGTTCCGTCAGCACAACA 59.823 50.000 0.00 0.00 0.00 3.33
2367 2411 0.326238 ATTCGGACTAGGCCTTGGGA 60.326 55.000 12.58 5.62 0.00 4.37
2447 2493 2.616634 GGAATTCCCGTAACTCTCCC 57.383 55.000 14.03 0.00 0.00 4.30
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
41 42 1.068588 GATACCGTATCTGCAGGCACA 59.931 52.381 15.13 0.00 32.44 4.57
158 159 4.559862 CAGATGGGTCTGTTCCTTAGTT 57.440 45.455 0.00 0.00 45.51 2.24
176 177 4.365899 ACGCTTGACAATATCGTACAGA 57.634 40.909 8.03 0.00 0.00 3.41
393 405 5.769662 TCCAAACATGAGCTGTATGAAAACT 59.230 36.000 13.05 0.00 36.98 2.66
492 504 5.443693 GCAACTACGTTCGTCGACATTTTAT 60.444 40.000 17.16 0.00 42.86 1.40
807 823 3.059884 ACACAGTTTGTACGAGATGCAG 58.940 45.455 0.00 0.00 36.32 4.41
905 922 6.808008 AGAATCATGTAGACTGTTTGGTTG 57.192 37.500 0.00 0.00 0.00 3.77
1113 1131 3.869272 GCATCAGCTGCCGAACGG 61.869 66.667 9.47 9.00 45.66 4.44
1245 1263 1.523758 ACGTGTTCCCTTGCTTCATC 58.476 50.000 0.00 0.00 0.00 2.92
1386 1409 3.074412 AGTCCGTCCTGCACAATAAAAG 58.926 45.455 0.00 0.00 0.00 2.27
1463 1488 0.601558 ACGACCGTTGTAGCTGTGAT 59.398 50.000 0.00 0.00 0.00 3.06
1497 1522 3.125146 CGTCAACCAGTTCCATGTGTATG 59.875 47.826 0.00 0.00 0.00 2.39
1498 1523 3.007506 TCGTCAACCAGTTCCATGTGTAT 59.992 43.478 0.00 0.00 0.00 2.29
1536 1561 2.808315 CGTGCTCCAGACCGCTAT 59.192 61.111 0.00 0.00 0.00 2.97
1537 1562 4.129737 GCGTGCTCCAGACCGCTA 62.130 66.667 0.00 0.00 42.66 4.26
1600 1625 2.353030 TGTATCGCCGCGTGATCG 60.353 61.111 13.39 7.53 34.45 3.69
1770 1796 4.937201 TGATCTTGCGTGTATGTAGGAT 57.063 40.909 0.00 0.00 0.00 3.24
1852 1879 1.268032 CGCGTTGTCATAATGCTTCCC 60.268 52.381 0.00 0.00 0.00 3.97
1984 2011 2.437413 GAACTCATCCCCGAAGCTTTT 58.563 47.619 0.00 0.00 0.00 2.27
2017 2044 0.461548 ATCATCATCGTCACCACGCT 59.538 50.000 0.00 0.00 46.28 5.07
2447 2493 3.149436 TCGGGTATTTTTCGGAGTACG 57.851 47.619 0.00 0.00 46.11 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.