Multiple sequence alignment - TraesCS2B01G032800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G032800 chr2B 100.000 3135 0 0 1 3135 15790601 15787467 0.000000e+00 5790
1 TraesCS2B01G032800 chr2B 99.330 3135 20 1 1 3135 15727534 15724401 0.000000e+00 5672
2 TraesCS2B01G032800 chr2B 99.417 2916 16 1 1 2916 15962752 15959838 0.000000e+00 5289
3 TraesCS2B01G032800 chr2B 97.610 3012 65 4 1 3006 15883357 15880347 0.000000e+00 5156
4 TraesCS2B01G032800 chr2B 92.505 2535 152 14 265 2797 15119808 15117310 0.000000e+00 3594
5 TraesCS2B01G032800 chr2B 96.086 1482 37 3 1669 3135 15981712 15980237 0.000000e+00 2396
6 TraesCS2B01G032800 chr2B 94.635 466 14 1 2681 3135 15980226 15979761 0.000000e+00 712
7 TraesCS2B01G032800 chr2B 94.218 467 15 2 2681 3135 15880336 15879870 0.000000e+00 702
8 TraesCS2B01G032800 chrUn 99.547 2430 10 1 1 2430 339546411 339548839 0.000000e+00 4425
9 TraesCS2B01G032800 chrUn 99.424 2430 13 1 1 2430 339561632 339559204 0.000000e+00 4409
10 TraesCS2B01G032800 chrUn 98.079 2291 39 2 248 2534 345912908 345910619 0.000000e+00 3982
11 TraesCS2B01G032800 chrUn 97.921 2068 41 2 1 2067 349087521 349085455 0.000000e+00 3579
12 TraesCS2B01G032800 chrUn 97.872 2068 42 2 1 2067 349092536 349094602 0.000000e+00 3574
13 TraesCS2B01G032800 chrUn 98.865 705 7 1 2432 3135 466055961 466056665 0.000000e+00 1256
14 TraesCS2B01G032800 chrUn 94.635 466 14 1 2681 3135 250802853 250802388 0.000000e+00 712
15 TraesCS2B01G032800 chrUn 94.635 466 14 1 2681 3135 418029024 418028559 0.000000e+00 712
16 TraesCS2B01G032800 chrUn 96.484 256 8 1 1 255 328699734 328699989 3.740000e-114 422
17 TraesCS2B01G032800 chrUn 96.484 256 8 1 1 255 433700916 433700661 3.740000e-114 422
18 TraesCS2B01G032800 chr2A 88.787 2836 254 41 1 2797 11045477 11042667 0.000000e+00 3417
19 TraesCS2B01G032800 chr2D 93.354 2272 134 7 31 2287 10800801 10798532 0.000000e+00 3343
20 TraesCS2B01G032800 chr2D 92.668 491 28 6 2316 2801 10798534 10798047 0.000000e+00 701
21 TraesCS2B01G032800 chr2D 92.418 488 27 7 2316 2798 10250980 10251462 0.000000e+00 688
22 TraesCS2B01G032800 chr1D 90.208 337 32 1 2797 3133 342827063 342827398 3.710000e-119 438


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G032800 chr2B 15787467 15790601 3134 True 5790 5790 100.0000 1 3135 1 chr2B.!!$R3 3134
1 TraesCS2B01G032800 chr2B 15724401 15727534 3133 True 5672 5672 99.3300 1 3135 1 chr2B.!!$R2 3134
2 TraesCS2B01G032800 chr2B 15959838 15962752 2914 True 5289 5289 99.4170 1 2916 1 chr2B.!!$R4 2915
3 TraesCS2B01G032800 chr2B 15117310 15119808 2498 True 3594 3594 92.5050 265 2797 1 chr2B.!!$R1 2532
4 TraesCS2B01G032800 chr2B 15879870 15883357 3487 True 2929 5156 95.9140 1 3135 2 chr2B.!!$R5 3134
5 TraesCS2B01G032800 chr2B 15979761 15981712 1951 True 1554 2396 95.3605 1669 3135 2 chr2B.!!$R6 1466
6 TraesCS2B01G032800 chrUn 339546411 339548839 2428 False 4425 4425 99.5470 1 2430 1 chrUn.!!$F2 2429
7 TraesCS2B01G032800 chrUn 339559204 339561632 2428 True 4409 4409 99.4240 1 2430 1 chrUn.!!$R2 2429
8 TraesCS2B01G032800 chrUn 345910619 345912908 2289 True 3982 3982 98.0790 248 2534 1 chrUn.!!$R3 2286
9 TraesCS2B01G032800 chrUn 349085455 349087521 2066 True 3579 3579 97.9210 1 2067 1 chrUn.!!$R4 2066
10 TraesCS2B01G032800 chrUn 349092536 349094602 2066 False 3574 3574 97.8720 1 2067 1 chrUn.!!$F3 2066
11 TraesCS2B01G032800 chrUn 466055961 466056665 704 False 1256 1256 98.8650 2432 3135 1 chrUn.!!$F4 703
12 TraesCS2B01G032800 chr2A 11042667 11045477 2810 True 3417 3417 88.7870 1 2797 1 chr2A.!!$R1 2796
13 TraesCS2B01G032800 chr2D 10798047 10800801 2754 True 2022 3343 93.0110 31 2801 2 chr2D.!!$R1 2770

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
945 983 0.250684 TCTTTCCAGCGACATGGCAA 60.251 50.000 0.0 0.0 40.41 4.52 F
1734 1772 1.873591 CCCATACCATGCTCTTAACGC 59.126 52.381 0.0 0.0 0.00 4.84 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1899 1937 1.626321 TGAAACGTAGGCCTGGATCAA 59.374 47.619 17.99 0.0 0.00 2.57 R
2916 3814 2.737252 GAGGGATAAAAATCCGCGCTAG 59.263 50.000 5.56 0.0 41.63 3.42 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
945 983 0.250684 TCTTTCCAGCGACATGGCAA 60.251 50.000 0.0 0.0 40.41 4.52
1135 1173 5.559770 TCAACCATCTCTACATCTTTTGCA 58.440 37.500 0.0 0.0 0.00 4.08
1734 1772 1.873591 CCCATACCATGCTCTTAACGC 59.126 52.381 0.0 0.0 0.00 4.84
1808 1846 6.253946 AGGATAGCCACATACTTTTAAGCT 57.746 37.500 0.0 0.0 36.29 3.74
1899 1937 4.193826 ACACTGCGAATGTACTTCTCAT 57.806 40.909 0.0 0.0 28.68 2.90
2916 3814 6.911511 CCTCGCTACTACTGATTTGTTAGTAC 59.088 42.308 0.0 0.0 0.00 2.73
2961 3859 4.996122 GCTACTACTAAGCGGTCTCTATCA 59.004 45.833 0.0 0.0 0.00 2.15
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
945 983 5.787953 TGTTGACAATGTTGATTGGACAT 57.212 34.783 0.00 0.0 43.00 3.06
1127 1165 3.678056 AGTAGTCGGACATGCAAAAGA 57.322 42.857 11.27 0.0 0.00 2.52
1135 1173 1.553704 GGTTGGGAAGTAGTCGGACAT 59.446 52.381 11.27 0.0 0.00 3.06
1753 1791 2.867109 AGCCAGCAATAGTTGTGTCT 57.133 45.000 0.00 0.0 0.00 3.41
1899 1937 1.626321 TGAAACGTAGGCCTGGATCAA 59.374 47.619 17.99 0.0 0.00 2.57
2916 3814 2.737252 GAGGGATAAAAATCCGCGCTAG 59.263 50.000 5.56 0.0 41.63 3.42


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.