Multiple sequence alignment - TraesCS2B01G032600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G032600 chr2B 100.000 5063 0 0 1 5063 15742946 15748008 0.000000e+00 9350.0
1 TraesCS2B01G032600 chr2B 99.111 5063 43 1 1 5063 15680695 15685755 0.000000e+00 9099.0
2 TraesCS2B01G032600 chr2B 98.775 5063 60 2 1 5063 15804717 15809777 0.000000e+00 9005.0
3 TraesCS2B01G032600 chr2B 98.658 4099 54 1 1 4099 15903057 15907154 0.000000e+00 7263.0
4 TraesCS2B01G032600 chr2B 92.857 1484 98 5 2923 4401 15699165 15700645 0.000000e+00 2146.0
5 TraesCS2B01G032600 chr2B 92.857 1484 98 5 2923 4401 15822473 15823953 0.000000e+00 2146.0
6 TraesCS2B01G032600 chr2B 91.285 1331 94 13 549 1870 15820720 15822037 0.000000e+00 1796.0
7 TraesCS2B01G032600 chr2B 91.210 1331 95 13 549 1870 15759536 15760853 0.000000e+00 1790.0
8 TraesCS2B01G032600 chr2B 91.059 1331 96 14 549 1870 15697413 15698729 0.000000e+00 1777.0
9 TraesCS2B01G032600 chr2B 91.517 1167 84 8 710 1870 15762432 15763589 0.000000e+00 1592.0
10 TraesCS2B01G032600 chr2B 86.650 412 39 8 2520 2918 15698721 15699129 4.650000e-120 442.0
11 TraesCS2B01G032600 chr2B 86.408 412 40 8 2520 2918 15760845 15761253 2.160000e-118 436.0
12 TraesCS2B01G032600 chr2B 86.408 412 40 8 2520 2918 15822029 15822437 2.160000e-118 436.0
13 TraesCS2B01G032600 chr2B 86.386 404 37 11 2520 2909 15763581 15763980 4.690000e-115 425.0
14 TraesCS2B01G032600 chr2B 88.473 347 34 6 4717 5061 15873196 15873538 1.010000e-111 414.0
15 TraesCS2B01G032600 chr2B 88.473 347 34 6 4717 5061 15973128 15973470 1.010000e-111 414.0
16 TraesCS2B01G032600 chr2B 88.197 305 32 4 4717 5020 15771056 15771357 1.340000e-95 361.0
17 TraesCS2B01G032600 chr2B 96.447 197 6 1 1898 2094 577237727 577237532 1.760000e-84 324.0
18 TraesCS2B01G032600 chr2B 84.802 329 37 6 2202 2518 789132703 789132376 8.180000e-83 318.0
19 TraesCS2B01G032600 chr2B 89.080 174 18 1 138 311 15805515 15805687 1.100000e-51 215.0
20 TraesCS2B01G032600 chr2B 89.080 174 18 1 138 311 15903855 15904027 1.100000e-51 215.0
21 TraesCS2B01G032600 chr2B 88.953 172 19 0 138 309 15681493 15681664 3.970000e-51 213.0
22 TraesCS2B01G032600 chr2B 90.184 163 16 0 149 311 15697668 15697830 3.970000e-51 213.0
23 TraesCS2B01G032600 chr2B 90.184 163 16 0 149 311 15759791 15759953 3.970000e-51 213.0
24 TraesCS2B01G032600 chrUn 99.535 2368 11 0 1732 4099 255038573 255036206 0.000000e+00 4313.0
25 TraesCS2B01G032600 chrUn 97.795 2086 45 1 347 2432 354974127 354972043 0.000000e+00 3596.0
26 TraesCS2B01G032600 chrUn 99.479 1536 7 1 3433 4968 391312988 391314522 0.000000e+00 2791.0
27 TraesCS2B01G032600 chrUn 78.596 1140 230 10 2930 4059 38680061 38678926 0.000000e+00 741.0
28 TraesCS2B01G032600 chrUn 88.473 347 34 6 4717 5061 250795712 250796054 1.010000e-111 414.0
29 TraesCS2B01G032600 chrUn 88.473 347 34 6 4717 5061 258356444 258356102 1.010000e-111 414.0
30 TraesCS2B01G032600 chrUn 88.473 347 34 6 4717 5061 363334329 363334671 1.010000e-111 414.0
31 TraesCS2B01G032600 chrUn 87.143 350 38 4 4056 4401 439973634 439973980 1.710000e-104 390.0
32 TraesCS2B01G032600 chrUn 87.385 325 36 4 2195 2518 71298374 71298054 8.010000e-98 368.0
33 TraesCS2B01G032600 chrUn 89.080 174 18 1 138 311 354973675 354973503 1.100000e-51 215.0
34 TraesCS2B01G032600 chr2A 91.175 1915 120 29 2520 4395 11216160 11218064 0.000000e+00 2555.0
35 TraesCS2B01G032600 chr2A 93.297 1477 90 8 2921 4395 11189170 11190639 0.000000e+00 2170.0
36 TraesCS2B01G032600 chr2A 91.263 1488 110 9 391 1870 11140293 11141768 0.000000e+00 2010.0
37 TraesCS2B01G032600 chr2A 93.870 522 23 6 318 839 11214685 11215197 0.000000e+00 778.0
38 TraesCS2B01G032600 chr2A 92.581 310 22 1 2606 2914 11188824 11189133 1.290000e-120 444.0
39 TraesCS2B01G032600 chr2A 96.954 197 4 2 1909 2105 527913702 527913508 3.780000e-86 329.0
40 TraesCS2B01G032600 chr7D 93.243 296 19 1 4427 4721 29971647 29971352 7.780000e-118 435.0
41 TraesCS2B01G032600 chr1D 88.022 359 31 7 2171 2518 11137512 11137869 1.010000e-111 414.0
42 TraesCS2B01G032600 chr1D 87.423 326 33 6 2195 2515 493379005 493379327 8.010000e-98 368.0
43 TraesCS2B01G032600 chr7B 87.654 324 32 5 2195 2518 744931927 744931612 2.230000e-98 370.0
44 TraesCS2B01G032600 chr4D 92.063 252 18 2 4471 4721 120448155 120448405 2.240000e-93 353.0
45 TraesCS2B01G032600 chr4A 96.098 205 7 1 1907 2110 531079322 531079118 2.920000e-87 333.0
46 TraesCS2B01G032600 chr4A 95.939 197 7 1 1898 2094 67310552 67310747 8.180000e-83 318.0
47 TraesCS2B01G032600 chr1A 98.925 186 2 0 1911 2096 162803344 162803529 2.920000e-87 333.0
48 TraesCS2B01G032600 chr6B 96.954 197 4 2 1911 2107 62703775 62703969 3.780000e-86 329.0
49 TraesCS2B01G032600 chr6B 90.909 77 7 0 2097 2173 112345052 112345128 2.490000e-18 104.0
50 TraesCS2B01G032600 chr6B 71.914 324 77 11 1161 1477 31016299 31015983 1.170000e-11 82.4
51 TraesCS2B01G032600 chr1B 89.349 169 11 3 1899 2062 375421894 375422060 6.640000e-49 206.0
52 TraesCS2B01G032600 chr1B 96.154 78 3 0 2096 2173 80808577 80808654 1.480000e-25 128.0
53 TraesCS2B01G032600 chr1B 93.590 78 5 0 2096 2173 80768665 80768742 3.200000e-22 117.0
54 TraesCS2B01G032600 chr1B 92.308 78 6 0 2096 2173 80841673 80841750 1.490000e-20 111.0
55 TraesCS2B01G032600 chr5A 97.872 94 2 0 1901 1994 472557276 472557183 4.060000e-36 163.0
56 TraesCS2B01G032600 chr5A 80.282 142 24 1 470 611 468881052 468881189 2.490000e-18 104.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G032600 chr2B 15742946 15748008 5062 False 9350.000000 9350 100.000000 1 5063 1 chr2B.!!$F3 5062
1 TraesCS2B01G032600 chr2B 15680695 15685755 5060 False 9099.000000 9099 99.111000 1 5063 1 chr2B.!!$F1 5062
2 TraesCS2B01G032600 chr2B 15804717 15809777 5060 False 9005.000000 9005 98.775000 1 5063 1 chr2B.!!$F5 5062
3 TraesCS2B01G032600 chr2B 15903057 15907154 4097 False 3739.000000 7263 93.869000 1 4099 2 chr2B.!!$F12 4098
4 TraesCS2B01G032600 chr2B 15820720 15823953 3233 False 1459.333333 2146 90.183333 549 4401 3 chr2B.!!$F11 3852
5 TraesCS2B01G032600 chr2B 15697413 15700645 3232 False 1144.500000 2146 90.187500 149 4401 4 chr2B.!!$F9 4252
6 TraesCS2B01G032600 chr2B 15759536 15763980 4444 False 891.200000 1790 89.141000 149 2918 5 chr2B.!!$F10 2769
7 TraesCS2B01G032600 chrUn 255036206 255038573 2367 True 4313.000000 4313 99.535000 1732 4099 1 chrUn.!!$R3 2367
8 TraesCS2B01G032600 chrUn 391312988 391314522 1534 False 2791.000000 2791 99.479000 3433 4968 1 chrUn.!!$F3 1535
9 TraesCS2B01G032600 chrUn 354972043 354974127 2084 True 1905.500000 3596 93.437500 138 2432 2 chrUn.!!$R5 2294
10 TraesCS2B01G032600 chrUn 38678926 38680061 1135 True 741.000000 741 78.596000 2930 4059 1 chrUn.!!$R1 1129
11 TraesCS2B01G032600 chr2A 11140293 11141768 1475 False 2010.000000 2010 91.263000 391 1870 1 chr2A.!!$F1 1479
12 TraesCS2B01G032600 chr2A 11214685 11218064 3379 False 1666.500000 2555 92.522500 318 4395 2 chr2A.!!$F3 4077
13 TraesCS2B01G032600 chr2A 11188824 11190639 1815 False 1307.000000 2170 92.939000 2606 4395 2 chr2A.!!$F2 1789

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
969 975 1.524621 AATTGCGCCGCATAGCTCT 60.525 52.632 14.63 0.0 38.76 4.09 F
1995 2011 2.061509 TGGGTCTATAGTACGCAGCA 57.938 50.000 13.98 0.0 35.18 4.41 F
2046 2062 1.073763 CAGGACTTGAACCCATGACCA 59.926 52.381 0.00 0.0 35.71 4.02 F
2148 2164 2.307309 CGCGCTTCCACTTTCGTGA 61.307 57.895 5.56 0.0 43.97 4.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2046 2062 0.892358 CTGCTGCCTTGTGACCATGT 60.892 55.000 0.00 0.0 0.00 3.21 R
2903 3182 3.138884 TGCACAATTGTTAGCAGAGGA 57.861 42.857 17.07 0.3 32.48 3.71 R
3283 3593 9.666626 CAAGAGAATATCGACGAAATTACTACT 57.333 33.333 0.00 0.0 0.00 2.57 R
4424 4986 3.505386 ACAGGTGTAATCCCATTGCAAA 58.495 40.909 1.71 0.0 36.64 3.68 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
870 876 4.947147 TGCACCCCACAGCGGTTC 62.947 66.667 0.00 0.0 0.00 3.62
969 975 1.524621 AATTGCGCCGCATAGCTCT 60.525 52.632 14.63 0.0 38.76 4.09
1995 2011 2.061509 TGGGTCTATAGTACGCAGCA 57.938 50.000 13.98 0.0 35.18 4.41
2046 2062 1.073763 CAGGACTTGAACCCATGACCA 59.926 52.381 0.00 0.0 35.71 4.02
2148 2164 2.307309 CGCGCTTCCACTTTCGTGA 61.307 57.895 5.56 0.0 43.97 4.35
2152 2168 2.793237 GCGCTTCCACTTTCGTGAAAAA 60.793 45.455 0.00 0.0 43.97 1.94
3283 3593 6.295123 GGACAAGTCAGTGTTAGATAACCAGA 60.295 42.308 2.29 0.0 35.37 3.86
4997 6285 9.780186 GCCTAGCTTTCCTTTATCTAGAAAATA 57.220 33.333 0.00 0.0 30.97 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
292 293 1.744368 CTGGAGCTCTGCGTTGCAT 60.744 57.895 14.64 0.0 38.13 3.96
870 876 2.989840 CAGGCAGAGTACTTGAAACGAG 59.010 50.000 0.00 0.0 0.00 4.18
969 975 3.192541 TGTCTAGCACAGCACTTTCAA 57.807 42.857 0.00 0.0 0.00 2.69
1269 1275 2.705826 GGCGACGATACGACGAGT 59.294 61.111 17.69 0.0 46.01 4.18
1995 2011 6.069381 AGCCTCTTACAGAAATGTAGGGAAAT 60.069 38.462 0.00 0.0 0.00 2.17
2046 2062 0.892358 CTGCTGCCTTGTGACCATGT 60.892 55.000 0.00 0.0 0.00 3.21
2148 2164 2.554032 CCGACTGTTGCCTCTGATTTTT 59.446 45.455 0.00 0.0 0.00 1.94
2152 2168 1.599047 CCCGACTGTTGCCTCTGAT 59.401 57.895 0.00 0.0 0.00 2.90
2313 2329 5.752955 TGAAGTTTTGAGCATTTTTAGCACC 59.247 36.000 0.00 0.0 0.00 5.01
2903 3182 3.138884 TGCACAATTGTTAGCAGAGGA 57.861 42.857 17.07 0.3 32.48 3.71
3283 3593 9.666626 CAAGAGAATATCGACGAAATTACTACT 57.333 33.333 0.00 0.0 0.00 2.57
4424 4986 3.505386 ACAGGTGTAATCCCATTGCAAA 58.495 40.909 1.71 0.0 36.64 3.68


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.