Multiple sequence alignment - TraesCS2B01G031400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G031400 chr2B 100.000 3196 0 0 1 3196 14461254 14458059 0.000000e+00 5903
1 TraesCS2B01G031400 chr2B 99.531 3197 14 1 1 3196 14490051 14486855 0.000000e+00 5819
2 TraesCS2B01G031400 chr2B 99.387 2772 15 2 1 2771 14435661 14432891 0.000000e+00 5024
3 TraesCS2B01G031400 chr2B 95.807 1908 66 3 878 2771 14350686 14348779 0.000000e+00 3068
4 TraesCS2B01G031400 chr2B 87.362 1630 143 32 896 2499 14505497 14503905 0.000000e+00 1810
5 TraesCS2B01G031400 chr2B 85.637 1671 157 43 878 2500 14618874 14617239 0.000000e+00 1679
6 TraesCS2B01G031400 chr2B 86.327 1119 95 27 1403 2499 14477753 14476671 0.000000e+00 1166
7 TraesCS2B01G031400 chr2B 87.725 1002 78 16 1521 2495 15463484 15464467 0.000000e+00 1127
8 TraesCS2B01G031400 chr2B 92.390 657 46 4 878 1531 15462803 15463458 0.000000e+00 933
9 TraesCS2B01G031400 chr2B 84.783 920 82 31 1618 2512 14405585 14404699 0.000000e+00 870
10 TraesCS2B01G031400 chr2B 99.279 416 3 0 2781 3196 14513852 14513437 0.000000e+00 752
11 TraesCS2B01G031400 chr2B 89.607 433 31 4 1534 1954 13911849 13912279 3.630000e-149 538
12 TraesCS2B01G031400 chr2B 94.521 73 3 1 2693 2765 14441411 14441340 9.370000e-21 111
13 TraesCS2B01G031400 chr2B 91.139 79 6 1 2693 2771 14495694 14495617 4.360000e-19 106
14 TraesCS2B01G031400 chrUn 100.000 1627 0 0 1 1627 329539447 329537821 0.000000e+00 3005
15 TraesCS2B01G031400 chrUn 95.620 822 28 7 14 832 17112939 17112123 0.000000e+00 1312
16 TraesCS2B01G031400 chrUn 88.022 1077 97 20 896 1958 353662585 353661527 0.000000e+00 1245
17 TraesCS2B01G031400 chrUn 96.241 665 19 5 170 832 443567358 443566698 0.000000e+00 1085
18 TraesCS2B01G031400 chrUn 86.364 550 44 9 1962 2499 461723465 461722935 3.580000e-159 571
19 TraesCS2B01G031400 chrUn 93.151 73 4 1 2693 2765 368708944 368709015 4.360000e-19 106
20 TraesCS2B01G031400 chr2A 88.545 1650 141 22 878 2504 10845133 10843509 0.000000e+00 1956
21 TraesCS2B01G031400 chr2A 86.300 1292 123 32 1262 2504 10735681 10734395 0.000000e+00 1356
22 TraesCS2B01G031400 chr7B 96.364 825 19 11 12 832 481816762 481815945 0.000000e+00 1347
23 TraesCS2B01G031400 chr7B 96.633 802 19 7 34 832 43499855 43500651 0.000000e+00 1325
24 TraesCS2B01G031400 chr4A 95.504 823 31 6 12 832 655746940 655747758 0.000000e+00 1310
25 TraesCS2B01G031400 chr4A 86.364 418 54 2 2782 3196 387090217 387090634 1.350000e-123 453
26 TraesCS2B01G031400 chr2D 87.653 980 79 11 1550 2504 10433585 10432623 0.000000e+00 1101
27 TraesCS2B01G031400 chr2D 87.653 980 79 10 1550 2504 10530000 10529038 0.000000e+00 1101
28 TraesCS2B01G031400 chr2D 92.846 657 43 4 878 1531 10530703 10530048 0.000000e+00 950
29 TraesCS2B01G031400 chr2D 93.250 637 42 1 896 1531 10434268 10433632 0.000000e+00 937
30 TraesCS2B01G031400 chr2D 89.831 177 17 1 2507 2682 128025946 128025770 3.210000e-55 226
31 TraesCS2B01G031400 chr6B 92.897 718 40 9 126 836 46931573 46932286 0.000000e+00 1033
32 TraesCS2B01G031400 chr6B 95.633 229 9 1 21 248 675225074 675225302 1.810000e-97 366
33 TraesCS2B01G031400 chr1D 90.909 418 34 2 2782 3196 141195869 141195453 2.780000e-155 558
34 TraesCS2B01G031400 chr3B 90.394 406 34 3 2795 3196 23464873 23465277 2.180000e-146 529
35 TraesCS2B01G031400 chr3B 82.339 419 71 1 2781 3196 164486576 164486994 8.430000e-96 361
36 TraesCS2B01G031400 chr5D 83.771 419 63 4 2782 3196 208186550 208186967 2.990000e-105 392
37 TraesCS2B01G031400 chr7D 83.532 419 66 2 2781 3196 168416274 168416692 3.870000e-104 388
38 TraesCS2B01G031400 chr7D 91.061 179 11 4 2507 2682 621640473 621640649 1.480000e-58 237
39 TraesCS2B01G031400 chr3D 83.294 419 67 2 2781 3196 557251621 557251203 1.800000e-102 383
40 TraesCS2B01G031400 chr3D 89.326 178 14 5 2507 2681 436020251 436020076 5.370000e-53 219
41 TraesCS2B01G031400 chr6A 90.395 177 16 1 2507 2682 477039814 477039638 6.890000e-57 231
42 TraesCS2B01G031400 chr5B 90.503 179 11 5 2507 2682 445200112 445199937 6.890000e-57 231
43 TraesCS2B01G031400 chr1A 89.831 177 17 1 2507 2682 440899243 440899067 3.210000e-55 226


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G031400 chr2B 14458059 14461254 3195 True 5903.0 5903 100.0000 1 3196 1 chr2B.!!$R5 3195
1 TraesCS2B01G031400 chr2B 14486855 14490051 3196 True 5819.0 5819 99.5310 1 3196 1 chr2B.!!$R7 3195
2 TraesCS2B01G031400 chr2B 14432891 14435661 2770 True 5024.0 5024 99.3870 1 2771 1 chr2B.!!$R3 2770
3 TraesCS2B01G031400 chr2B 14348779 14350686 1907 True 3068.0 3068 95.8070 878 2771 1 chr2B.!!$R1 1893
4 TraesCS2B01G031400 chr2B 14503905 14505497 1592 True 1810.0 1810 87.3620 896 2499 1 chr2B.!!$R9 1603
5 TraesCS2B01G031400 chr2B 14617239 14618874 1635 True 1679.0 1679 85.6370 878 2500 1 chr2B.!!$R11 1622
6 TraesCS2B01G031400 chr2B 14476671 14477753 1082 True 1166.0 1166 86.3270 1403 2499 1 chr2B.!!$R6 1096
7 TraesCS2B01G031400 chr2B 15462803 15464467 1664 False 1030.0 1127 90.0575 878 2495 2 chr2B.!!$F2 1617
8 TraesCS2B01G031400 chr2B 14404699 14405585 886 True 870.0 870 84.7830 1618 2512 1 chr2B.!!$R2 894
9 TraesCS2B01G031400 chrUn 329537821 329539447 1626 True 3005.0 3005 100.0000 1 1627 1 chrUn.!!$R2 1626
10 TraesCS2B01G031400 chrUn 17112123 17112939 816 True 1312.0 1312 95.6200 14 832 1 chrUn.!!$R1 818
11 TraesCS2B01G031400 chrUn 353661527 353662585 1058 True 1245.0 1245 88.0220 896 1958 1 chrUn.!!$R3 1062
12 TraesCS2B01G031400 chrUn 443566698 443567358 660 True 1085.0 1085 96.2410 170 832 1 chrUn.!!$R4 662
13 TraesCS2B01G031400 chrUn 461722935 461723465 530 True 571.0 571 86.3640 1962 2499 1 chrUn.!!$R5 537
14 TraesCS2B01G031400 chr2A 10843509 10845133 1624 True 1956.0 1956 88.5450 878 2504 1 chr2A.!!$R2 1626
15 TraesCS2B01G031400 chr2A 10734395 10735681 1286 True 1356.0 1356 86.3000 1262 2504 1 chr2A.!!$R1 1242
16 TraesCS2B01G031400 chr7B 481815945 481816762 817 True 1347.0 1347 96.3640 12 832 1 chr7B.!!$R1 820
17 TraesCS2B01G031400 chr7B 43499855 43500651 796 False 1325.0 1325 96.6330 34 832 1 chr7B.!!$F1 798
18 TraesCS2B01G031400 chr4A 655746940 655747758 818 False 1310.0 1310 95.5040 12 832 1 chr4A.!!$F2 820
19 TraesCS2B01G031400 chr2D 10529038 10530703 1665 True 1025.5 1101 90.2495 878 2504 2 chr2D.!!$R3 1626
20 TraesCS2B01G031400 chr2D 10432623 10434268 1645 True 1019.0 1101 90.4515 896 2504 2 chr2D.!!$R2 1608
21 TraesCS2B01G031400 chr6B 46931573 46932286 713 False 1033.0 1033 92.8970 126 836 1 chr6B.!!$F1 710

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1671 1734 6.147656 CGAATACATGCAAGCACTATATTCCA 59.852 38.462 18.93 0.0 31.09 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3132 3232 1.54782 GAGCTCATGAGGACTGTCACA 59.452 52.381 23.89 9.45 0.0 3.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1671 1734 6.147656 CGAATACATGCAAGCACTATATTCCA 59.852 38.462 18.93 0.0 31.09 3.53
2077 2169 1.674221 GCTCTGCAACCCACTCTGTAG 60.674 57.143 0.00 0.0 0.00 2.74
2685 2785 2.029918 GCTACCAAAAGAACTGGCTTGG 60.030 50.000 0.00 0.0 43.33 3.61
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
3043 3143 1.83363 TGGGATTCTCACGAGCAAGAT 59.166 47.619 0.00 0.00 0.0 2.40
3132 3232 1.54782 GAGCTCATGAGGACTGTCACA 59.452 52.381 23.89 9.45 0.0 3.58


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.