Multiple sequence alignment - TraesCS2B01G031300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G031300 chr2B 100.000 3196 0 0 1 3196 14435661 14432466 0.000000e+00 5903
1 TraesCS2B01G031300 chr2B 99.423 2773 13 3 1 2771 14490051 14487280 0.000000e+00 5029
2 TraesCS2B01G031300 chr2B 99.387 2772 15 2 1 2771 14461254 14458484 0.000000e+00 5024
3 TraesCS2B01G031300 chr2B 95.565 2142 79 5 879 3005 14350686 14348546 0.000000e+00 3415
4 TraesCS2B01G031300 chr2B 87.239 1630 144 33 897 2499 14505497 14503905 0.000000e+00 1799
5 TraesCS2B01G031300 chr2B 85.398 1671 160 44 879 2500 14618874 14617239 0.000000e+00 1657
6 TraesCS2B01G031300 chr2B 86.238 1119 96 27 1403 2499 14477753 14476671 0.000000e+00 1160
7 TraesCS2B01G031300 chr2B 87.525 1002 80 16 1521 2495 15463484 15464467 0.000000e+00 1116
8 TraesCS2B01G031300 chr2B 92.085 657 47 5 879 1531 15462803 15463458 0.000000e+00 920
9 TraesCS2B01G031300 chr2B 84.674 920 83 31 1618 2512 14405585 14404699 0.000000e+00 865
10 TraesCS2B01G031300 chr2B 89.231 520 38 7 2693 3196 14441411 14440894 4.500000e-178 634
11 TraesCS2B01G031300 chr2B 89.231 520 39 3 2693 3196 14495694 14495176 4.500000e-178 634
12 TraesCS2B01G031300 chr2B 89.145 433 33 4 1534 1954 13911849 13912279 7.850000e-146 527
13 TraesCS2B01G031300 chr2B 93.720 207 12 1 2991 3196 14466585 14466379 3.100000e-80 309
14 TraesCS2B01G031300 chrUn 99.386 1628 8 2 1 1627 329539447 329537821 0.000000e+00 2950
15 TraesCS2B01G031300 chrUn 95.626 823 27 8 14 833 17112939 17112123 0.000000e+00 1312
16 TraesCS2B01G031300 chrUn 87.837 1077 98 21 897 1958 353662585 353661527 0.000000e+00 1232
17 TraesCS2B01G031300 chrUn 95.952 667 20 6 169 833 443567359 443566698 0.000000e+00 1075
18 TraesCS2B01G031300 chrUn 89.231 520 39 3 2693 3196 368708944 368709462 4.500000e-178 634
19 TraesCS2B01G031300 chrUn 86.364 550 44 9 1962 2499 461723465 461722935 3.580000e-159 571
20 TraesCS2B01G031300 chr2A 88.303 1650 144 23 879 2504 10845133 10843509 0.000000e+00 1932
21 TraesCS2B01G031300 chr2A 86.223 1292 124 32 1262 2504 10735681 10734395 0.000000e+00 1351
22 TraesCS2B01G031300 chr7B 96.247 826 19 12 12 833 481816762 481815945 0.000000e+00 1343
23 TraesCS2B01G031300 chr7B 96.638 803 18 8 34 833 43499855 43500651 0.000000e+00 1325
24 TraesCS2B01G031300 chr4A 95.510 824 30 7 12 833 655746940 655747758 0.000000e+00 1310
25 TraesCS2B01G031300 chr2D 87.449 980 81 11 1550 2504 10433585 10432623 0.000000e+00 1090
26 TraesCS2B01G031300 chr2D 87.449 980 81 10 1550 2504 10530000 10529038 0.000000e+00 1090
27 TraesCS2B01G031300 chr2D 92.542 657 44 5 879 1531 10530703 10530048 0.000000e+00 937
28 TraesCS2B01G031300 chr2D 92.936 637 43 2 897 1531 10434268 10433632 0.000000e+00 926
29 TraesCS2B01G031300 chr2D 89.831 177 17 1 2507 2682 128025946 128025770 3.210000e-55 226
30 TraesCS2B01G031300 chr6B 92.490 719 42 10 126 837 46931573 46932286 0.000000e+00 1018
31 TraesCS2B01G031300 chr6B 96.943 229 6 1 21 248 675225074 675225302 1.800000e-102 383
32 TraesCS2B01G031300 chr7D 91.061 179 11 4 2507 2682 621640473 621640649 1.480000e-58 237
33 TraesCS2B01G031300 chr6A 90.395 177 16 1 2507 2682 477039814 477039638 6.890000e-57 231
34 TraesCS2B01G031300 chr5B 90.503 179 11 5 2507 2682 445200112 445199937 6.890000e-57 231
35 TraesCS2B01G031300 chr1A 89.831 177 17 1 2507 2682 440899243 440899067 3.210000e-55 226
36 TraesCS2B01G031300 chr3D 89.326 178 14 5 2507 2681 436020251 436020076 5.370000e-53 219


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G031300 chr2B 14432466 14435661 3195 True 5903.0 5903 100.0000 1 3196 1 chr2B.!!$R3 3195
1 TraesCS2B01G031300 chr2B 14487280 14490051 2771 True 5029.0 5029 99.4230 1 2771 1 chr2B.!!$R8 2770
2 TraesCS2B01G031300 chr2B 14458484 14461254 2770 True 5024.0 5024 99.3870 1 2771 1 chr2B.!!$R5 2770
3 TraesCS2B01G031300 chr2B 14348546 14350686 2140 True 3415.0 3415 95.5650 879 3005 1 chr2B.!!$R1 2126
4 TraesCS2B01G031300 chr2B 14503905 14505497 1592 True 1799.0 1799 87.2390 897 2499 1 chr2B.!!$R10 1602
5 TraesCS2B01G031300 chr2B 14617239 14618874 1635 True 1657.0 1657 85.3980 879 2500 1 chr2B.!!$R11 1621
6 TraesCS2B01G031300 chr2B 14476671 14477753 1082 True 1160.0 1160 86.2380 1403 2499 1 chr2B.!!$R7 1096
7 TraesCS2B01G031300 chr2B 15462803 15464467 1664 False 1018.0 1116 89.8050 879 2495 2 chr2B.!!$F2 1616
8 TraesCS2B01G031300 chr2B 14404699 14405585 886 True 865.0 865 84.6740 1618 2512 1 chr2B.!!$R2 894
9 TraesCS2B01G031300 chr2B 14440894 14441411 517 True 634.0 634 89.2310 2693 3196 1 chr2B.!!$R4 503
10 TraesCS2B01G031300 chr2B 14495176 14495694 518 True 634.0 634 89.2310 2693 3196 1 chr2B.!!$R9 503
11 TraesCS2B01G031300 chrUn 329537821 329539447 1626 True 2950.0 2950 99.3860 1 1627 1 chrUn.!!$R2 1626
12 TraesCS2B01G031300 chrUn 17112123 17112939 816 True 1312.0 1312 95.6260 14 833 1 chrUn.!!$R1 819
13 TraesCS2B01G031300 chrUn 353661527 353662585 1058 True 1232.0 1232 87.8370 897 1958 1 chrUn.!!$R3 1061
14 TraesCS2B01G031300 chrUn 443566698 443567359 661 True 1075.0 1075 95.9520 169 833 1 chrUn.!!$R4 664
15 TraesCS2B01G031300 chrUn 368708944 368709462 518 False 634.0 634 89.2310 2693 3196 1 chrUn.!!$F1 503
16 TraesCS2B01G031300 chrUn 461722935 461723465 530 True 571.0 571 86.3640 1962 2499 1 chrUn.!!$R5 537
17 TraesCS2B01G031300 chr2A 10843509 10845133 1624 True 1932.0 1932 88.3030 879 2504 1 chr2A.!!$R2 1625
18 TraesCS2B01G031300 chr2A 10734395 10735681 1286 True 1351.0 1351 86.2230 1262 2504 1 chr2A.!!$R1 1242
19 TraesCS2B01G031300 chr7B 481815945 481816762 817 True 1343.0 1343 96.2470 12 833 1 chr7B.!!$R1 821
20 TraesCS2B01G031300 chr7B 43499855 43500651 796 False 1325.0 1325 96.6380 34 833 1 chr7B.!!$F1 799
21 TraesCS2B01G031300 chr4A 655746940 655747758 818 False 1310.0 1310 95.5100 12 833 1 chr4A.!!$F1 821
22 TraesCS2B01G031300 chr2D 10529038 10530703 1665 True 1013.5 1090 89.9955 879 2504 2 chr2D.!!$R3 1625
23 TraesCS2B01G031300 chr2D 10432623 10434268 1645 True 1008.0 1090 90.1925 897 2504 2 chr2D.!!$R2 1607
24 TraesCS2B01G031300 chr6B 46931573 46932286 713 False 1018.0 1018 92.4900 126 837 1 chr6B.!!$F1 711

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
972 981 4.161001 GGATGAGGCAAGAACATTTTCCAT 59.839 41.667 0.00 0.0 31.28 3.41 F
1639 1735 5.773176 GGTGGGAAGAAATTCCTAGTGAAAA 59.227 40.000 6.95 0.0 40.90 2.29 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1822 1936 1.600957 CCATATCTCGCCACTGCAAAG 59.399 52.381 0.0 0.0 37.32 2.77 R
3171 3320 2.026262 ACACAACAACCCTTGACTCAGT 60.026 45.455 0.0 0.0 0.00 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
972 981 4.161001 GGATGAGGCAAGAACATTTTCCAT 59.839 41.667 0.00 0.00 31.28 3.41
1639 1735 5.773176 GGTGGGAAGAAATTCCTAGTGAAAA 59.227 40.000 6.95 0.00 40.90 2.29
2804 2937 6.520272 CCATTTGGTGGTCTTGATTTACAAA 58.480 36.000 0.00 0.00 43.44 2.83
2841 2974 5.592104 TCAATCTGCTCCGTAACAAGATA 57.408 39.130 0.00 0.00 0.00 1.98
3011 3159 4.681744 TGAGAACACAAAATGCTTCAACC 58.318 39.130 0.00 0.00 0.00 3.77
3012 3160 3.705604 AGAACACAAAATGCTTCAACCG 58.294 40.909 0.00 0.00 0.00 4.44
3016 3164 1.000274 ACAAAATGCTTCAACCGGAGC 60.000 47.619 9.46 7.31 0.00 4.70
3046 3194 5.596836 AAAATGTTTTCAGAGTTGAGGCA 57.403 34.783 0.00 0.00 34.15 4.75
3135 3284 5.316158 AGAAATAGGCAGCCTAACATCAT 57.684 39.130 25.49 5.73 39.77 2.45
3150 3299 9.658799 GCCTAACATCATCAGCTATTAGAATAA 57.341 33.333 0.00 0.00 0.00 1.40
3184 3333 2.705658 TGTCAATGACTGAGTCAAGGGT 59.294 45.455 20.26 0.00 45.96 4.34
3192 3341 2.026262 ACTGAGTCAAGGGTTGTTGTGT 60.026 45.455 0.00 0.00 0.00 3.72
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
972 981 4.265073 GAAGAGCTTTATGAGGGCTTTCA 58.735 43.478 0.00 0.0 36.37 2.69
1627 1723 2.974099 TCGGGGAGTTTTTCACTAGGAA 59.026 45.455 0.00 0.0 35.01 3.36
1639 1735 2.643551 CTTGCATGTATTCGGGGAGTT 58.356 47.619 0.00 0.0 0.00 3.01
1822 1936 1.600957 CCATATCTCGCCACTGCAAAG 59.399 52.381 0.00 0.0 37.32 2.77
2291 2424 1.623311 TCGACTTCCAAGCTTCCATGA 59.377 47.619 0.00 0.0 0.00 3.07
2804 2937 5.068460 AGCAGATTGAACTCGATACTTAGCT 59.932 40.000 0.00 0.0 0.00 3.32
3011 3159 6.083630 TGAAAACATTTTATTTCTCGCTCCG 58.916 36.000 0.00 0.0 36.68 4.63
3012 3160 7.305474 TCTGAAAACATTTTATTTCTCGCTCC 58.695 34.615 0.00 0.0 36.68 4.70
3016 3164 9.663904 TCAACTCTGAAAACATTTTATTTCTCG 57.336 29.630 0.00 0.0 36.68 4.04
3046 3194 8.650143 ATGGTGTTTGTTTATCCTTTATCTGT 57.350 30.769 0.00 0.0 0.00 3.41
3150 3299 7.105588 TCAGTCATTGACATGTGTAGCTTAAT 58.894 34.615 18.57 0.0 34.60 1.40
3151 3300 6.463360 TCAGTCATTGACATGTGTAGCTTAA 58.537 36.000 18.57 0.0 34.60 1.85
3171 3320 2.026262 ACACAACAACCCTTGACTCAGT 60.026 45.455 0.00 0.0 0.00 3.41
3172 3321 2.614057 GACACAACAACCCTTGACTCAG 59.386 50.000 0.00 0.0 0.00 3.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.