Multiple sequence alignment - TraesCS2B01G029000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G029000 chr2B 100.000 4124 0 0 1 4124 13388057 13392180 0.000000e+00 7616.0
1 TraesCS2B01G029000 chr2B 96.705 3338 79 5 788 4124 13338179 13341486 0.000000e+00 5526.0
2 TraesCS2B01G029000 chr2B 93.925 2683 143 11 787 3465 13201945 13204611 0.000000e+00 4034.0
3 TraesCS2B01G029000 chr2B 99.416 1883 9 2 787 2667 13358234 13360116 0.000000e+00 3415.0
4 TraesCS2B01G029000 chr2B 94.281 1189 62 4 2275 3461 13144730 13145914 0.000000e+00 1814.0
5 TraesCS2B01G029000 chr2B 97.458 118 3 0 4007 4124 13207507 13207624 6.990000e-48 202.0
6 TraesCS2B01G029000 chr2B 92.481 133 10 0 3811 3943 13152611 13152743 1.510000e-44 191.0
7 TraesCS2B01G029000 chr2B 93.220 118 8 0 4007 4124 13154044 13154161 1.520000e-39 174.0
8 TraesCS2B01G029000 chr2B 94.382 89 4 1 3657 3744 798809089 798809001 7.190000e-28 135.0
9 TraesCS2B01G029000 chr2B 100.000 44 0 0 3460 3503 13146043 13146086 9.500000e-12 82.4
10 TraesCS2B01G029000 chr2D 93.326 2682 165 7 787 3465 9856797 9859467 0.000000e+00 3949.0
11 TraesCS2B01G029000 chr2D 94.915 118 6 0 4007 4124 9873263 9873380 7.040000e-43 185.0
12 TraesCS2B01G029000 chr2D 90.977 133 12 0 3811 3943 9872716 9872848 3.280000e-41 180.0
13 TraesCS2B01G029000 chr2A 92.769 2683 176 10 787 3465 9939169 9936501 0.000000e+00 3864.0
14 TraesCS2B01G029000 chr2A 88.430 121 11 1 4007 4124 9904925 9904805 4.300000e-30 143.0
15 TraesCS2B01G029000 chr6B 98.982 786 8 0 1 786 127001111 127000326 0.000000e+00 1408.0
16 TraesCS2B01G029000 chr4B 98.729 787 7 2 1 786 395700213 395699429 0.000000e+00 1395.0
17 TraesCS2B01G029000 chr4B 98.477 788 9 2 1 786 620073220 620074006 0.000000e+00 1386.0
18 TraesCS2B01G029000 chr3B 98.728 786 9 1 1 786 654080888 654081672 0.000000e+00 1395.0
19 TraesCS2B01G029000 chr3B 98.602 787 11 0 1 787 754233698 754232912 0.000000e+00 1393.0
20 TraesCS2B01G029000 chr3B 92.473 93 7 0 3653 3745 807080270 807080178 2.590000e-27 134.0
21 TraesCS2B01G029000 chr5A 98.601 786 10 1 1 786 579829838 579829054 0.000000e+00 1389.0
22 TraesCS2B01G029000 chr5A 96.471 85 3 0 3666 3750 207681836 207681920 1.550000e-29 141.0
23 TraesCS2B01G029000 chr5A 97.531 81 2 0 3666 3746 564177716 564177636 5.560000e-29 139.0
24 TraesCS2B01G029000 chrUn 98.479 789 9 1 1 786 47904510 47903722 0.000000e+00 1387.0
25 TraesCS2B01G029000 chrUn 98.235 793 11 3 1 792 61806510 61805720 0.000000e+00 1384.0
26 TraesCS2B01G029000 chrUn 100.000 426 0 0 2090 2515 476519406 476519831 0.000000e+00 787.0
27 TraesCS2B01G029000 chrUn 100.000 397 0 0 866 1262 479131598 479131994 0.000000e+00 734.0
28 TraesCS2B01G029000 chrUn 100.000 311 0 0 3814 4124 477356242 477355932 3.580000e-160 575.0
29 TraesCS2B01G029000 chrUn 95.294 85 3 1 3666 3749 62663480 62663396 2.590000e-27 134.0
30 TraesCS2B01G029000 chr6A 98.477 788 9 2 1 786 572819746 572818960 0.000000e+00 1386.0
31 TraesCS2B01G029000 chr7B 75.816 889 198 13 2186 3067 586967317 586966439 6.330000e-118 435.0
32 TraesCS2B01G029000 chr3D 75.737 882 197 14 2182 3056 32586045 32586916 1.060000e-115 427.0
33 TraesCS2B01G029000 chr7D 75.352 852 184 19 2216 3055 543609156 543608319 1.800000e-103 387.0
34 TraesCS2B01G029000 chr7D 93.333 90 4 2 3663 3750 47416146 47416057 9.300000e-27 132.0
35 TraesCS2B01G029000 chr5B 93.478 92 5 1 3664 3754 380317958 380317867 7.190000e-28 135.0
36 TraesCS2B01G029000 chr6D 94.186 86 5 0 3666 3751 427966119 427966204 9.300000e-27 132.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G029000 chr2B 13388057 13392180 4123 False 7616.0 7616 100.0000 1 4124 1 chr2B.!!$F3 4123
1 TraesCS2B01G029000 chr2B 13338179 13341486 3307 False 5526.0 5526 96.7050 788 4124 1 chr2B.!!$F1 3336
2 TraesCS2B01G029000 chr2B 13358234 13360116 1882 False 3415.0 3415 99.4160 787 2667 1 chr2B.!!$F2 1880
3 TraesCS2B01G029000 chr2B 13201945 13207624 5679 False 2118.0 4034 95.6915 787 4124 2 chr2B.!!$F6 3337
4 TraesCS2B01G029000 chr2B 13144730 13146086 1356 False 948.2 1814 97.1405 2275 3503 2 chr2B.!!$F4 1228
5 TraesCS2B01G029000 chr2D 9856797 9859467 2670 False 3949.0 3949 93.3260 787 3465 1 chr2D.!!$F1 2678
6 TraesCS2B01G029000 chr2A 9936501 9939169 2668 True 3864.0 3864 92.7690 787 3465 1 chr2A.!!$R2 2678
7 TraesCS2B01G029000 chr6B 127000326 127001111 785 True 1408.0 1408 98.9820 1 786 1 chr6B.!!$R1 785
8 TraesCS2B01G029000 chr4B 395699429 395700213 784 True 1395.0 1395 98.7290 1 786 1 chr4B.!!$R1 785
9 TraesCS2B01G029000 chr4B 620073220 620074006 786 False 1386.0 1386 98.4770 1 786 1 chr4B.!!$F1 785
10 TraesCS2B01G029000 chr3B 654080888 654081672 784 False 1395.0 1395 98.7280 1 786 1 chr3B.!!$F1 785
11 TraesCS2B01G029000 chr3B 754232912 754233698 786 True 1393.0 1393 98.6020 1 787 1 chr3B.!!$R1 786
12 TraesCS2B01G029000 chr5A 579829054 579829838 784 True 1389.0 1389 98.6010 1 786 1 chr5A.!!$R2 785
13 TraesCS2B01G029000 chrUn 47903722 47904510 788 True 1387.0 1387 98.4790 1 786 1 chrUn.!!$R1 785
14 TraesCS2B01G029000 chrUn 61805720 61806510 790 True 1384.0 1384 98.2350 1 792 1 chrUn.!!$R2 791
15 TraesCS2B01G029000 chr6A 572818960 572819746 786 True 1386.0 1386 98.4770 1 786 1 chr6A.!!$R1 785
16 TraesCS2B01G029000 chr7B 586966439 586967317 878 True 435.0 435 75.8160 2186 3067 1 chr7B.!!$R1 881
17 TraesCS2B01G029000 chr3D 32586045 32586916 871 False 427.0 427 75.7370 2182 3056 1 chr3D.!!$F1 874
18 TraesCS2B01G029000 chr7D 543608319 543609156 837 True 387.0 387 75.3520 2216 3055 1 chr7D.!!$R2 839

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
693 698 0.250166 AAGCAACCGCGACTAAAGGT 60.250 50.000 8.23 0.0 45.49 3.50 F
781 788 1.343985 ACCAAAGGCCCTTTTTCCACT 60.344 47.619 5.84 0.0 30.60 4.00 F
1559 1566 1.077265 CCAACCAAGGGCTCCATGT 59.923 57.895 0.00 0.0 0.00 3.21 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1559 1566 1.268794 CCACAAACGGCGAAAACATCA 60.269 47.619 16.62 0.0 0.00 3.07 R
2515 2537 3.126514 GTCATGACAACTCTCATGCAAGG 59.873 47.826 21.07 0.0 45.01 3.61 R
3364 3392 2.000447 GCAGTGAAGAATACCCGTCAC 59.000 52.381 0.00 0.0 42.93 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
262 263 1.635487 CTGGATGGTTCAGGAGGGAAA 59.365 52.381 0.00 0.0 0.00 3.13
693 698 0.250166 AAGCAACCGCGACTAAAGGT 60.250 50.000 8.23 0.0 45.49 3.50
781 788 1.343985 ACCAAAGGCCCTTTTTCCACT 60.344 47.619 5.84 0.0 30.60 4.00
864 871 3.230134 TGGTTCAACAAGATCCCAAAGG 58.770 45.455 0.00 0.0 35.58 3.11
1361 1368 3.677190 CGGGTGGTACTTCAATTTGGTA 58.323 45.455 0.00 0.0 0.00 3.25
1559 1566 1.077265 CCAACCAAGGGCTCCATGT 59.923 57.895 0.00 0.0 0.00 3.21
2659 2682 5.625921 ACTTTAGTCGAGTTCTGACTACC 57.374 43.478 0.00 0.0 45.83 3.18
3364 3392 3.634568 TGTAGCCAAAACACATTTCCG 57.365 42.857 0.00 0.0 0.00 4.30
3811 6317 1.133915 AGCCTTGTTTTGGAGACGGAA 60.134 47.619 0.00 0.0 0.00 4.30
3812 6318 1.679153 GCCTTGTTTTGGAGACGGAAA 59.321 47.619 0.00 0.0 0.00 3.13
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
9 10 5.670792 ATTCACCGACCTTTGTATCTACA 57.329 39.130 0.00 0.00 0.00 2.74
693 698 4.770874 GCGCGACTAAAGCCCCCA 62.771 66.667 12.10 0.00 0.00 4.96
781 788 1.938585 AGACTTACTGCTGCCCACTA 58.061 50.000 0.00 0.00 0.00 2.74
1321 1328 4.686437 ACCCGGTCCATTCCCCCA 62.686 66.667 0.00 0.00 0.00 4.96
1361 1368 1.608717 GACTGCCTGACATCTCCGGT 61.609 60.000 0.00 0.00 0.00 5.28
1559 1566 1.268794 CCACAAACGGCGAAAACATCA 60.269 47.619 16.62 0.00 0.00 3.07
2515 2537 3.126514 GTCATGACAACTCTCATGCAAGG 59.873 47.826 21.07 0.00 45.01 3.61
2659 2682 5.090139 AGGTATCCTATGGTTCCTCTCATG 58.910 45.833 0.00 0.00 28.47 3.07
3364 3392 2.000447 GCAGTGAAGAATACCCGTCAC 59.000 52.381 0.00 0.00 42.93 3.67
3650 6155 6.662663 ATGGGACGGAGTACTATATAGGAAAC 59.337 42.308 14.25 8.89 42.21 2.78
3738 6243 8.580720 TGCAAAGTTTGGCTAAATTTATACTCA 58.419 29.630 17.11 0.00 0.00 3.41
3744 6249 5.918608 TGGTGCAAAGTTTGGCTAAATTTA 58.081 33.333 17.11 0.00 0.00 1.40
3811 6317 0.252103 TCCCAACCTACCGAGAGCTT 60.252 55.000 0.00 0.00 0.00 3.74
3812 6318 0.971447 GTCCCAACCTACCGAGAGCT 60.971 60.000 0.00 0.00 0.00 4.09


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.