Multiple sequence alignment - TraesCS2B01G022200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G022200 chr2B 100.000 2207 0 0 1 2207 10667329 10669535 0.000000e+00 4076
1 TraesCS2B01G022200 chr2B 98.415 2208 34 1 1 2207 390976306 390974099 0.000000e+00 3882
2 TraesCS2B01G022200 chr2B 93.614 689 42 2 630 1317 588687074 588686387 0.000000e+00 1027
3 TraesCS2B01G022200 chr2B 95.058 607 21 5 1391 1989 588686398 588685793 0.000000e+00 946
4 TraesCS2B01G022200 chr2B 93.794 564 29 5 755 1317 588685795 588685237 0.000000e+00 843
5 TraesCS2B01G022200 chr2B 93.483 445 28 1 1 445 406246081 406245638 0.000000e+00 660
6 TraesCS2B01G022200 chr1B 97.690 1905 28 2 305 2207 674642311 674640421 0.000000e+00 3260
7 TraesCS2B01G022200 chr1B 94.785 441 21 2 2 442 198559985 198560423 0.000000e+00 686
8 TraesCS2B01G022200 chr5A 97.963 1767 35 1 442 2207 109300372 109302138 0.000000e+00 3062
9 TraesCS2B01G022200 chr5A 97.528 445 11 0 1 445 109299806 109300250 0.000000e+00 761
10 TraesCS2B01G022200 chr2A 97.736 1767 37 2 442 2207 130179353 130177589 0.000000e+00 3038
11 TraesCS2B01G022200 chr2A 96.854 445 14 0 1 445 130179919 130179475 0.000000e+00 745
12 TraesCS2B01G022200 chr7D 91.502 1565 102 6 442 1995 301662657 301661113 0.000000e+00 2124
13 TraesCS2B01G022200 chr7D 94.662 637 22 1 927 1563 46096344 46096968 0.000000e+00 977
14 TraesCS2B01G022200 chr7D 91.896 654 43 5 1563 2207 46101977 46102629 0.000000e+00 905
15 TraesCS2B01G022200 chr7D 90.088 454 34 5 2 445 559672488 559672036 1.470000e-161 579
16 TraesCS2B01G022200 chr7D 93.766 385 20 3 442 825 46086186 46086567 1.900000e-160 575
17 TraesCS2B01G022200 chr1D 93.845 1251 48 7 967 2207 252590495 252591726 0.000000e+00 1857
18 TraesCS2B01G022200 chr1D 95.848 289 7 3 461 744 252586049 252586337 1.540000e-126 462
19 TraesCS2B01G022200 chr1D 96.429 280 7 2 461 737 252573482 252573761 2.000000e-125 459
20 TraesCS2B01G022200 chr7A 93.381 1254 53 7 967 2207 665832345 665831109 0.000000e+00 1829
21 TraesCS2B01G022200 chr7A 91.475 434 33 2 13 445 673020820 673021250 5.250000e-166 593
22 TraesCS2B01G022200 chr4A 92.070 1261 61 9 967 2207 713137572 713136331 0.000000e+00 1738
23 TraesCS2B01G022200 chr4A 91.176 442 29 3 1776 2207 504866808 504867249 1.890000e-165 592
24 TraesCS2B01G022200 chr6B 94.508 874 34 9 442 1314 26562197 26563057 0.000000e+00 1336
25 TraesCS2B01G022200 chr6A 92.474 877 34 9 442 1317 611534915 611534070 0.000000e+00 1225
26 TraesCS2B01G022200 chr6A 93.411 258 16 1 1951 2207 611533569 611533312 4.450000e-102 381
27 TraesCS2B01G022200 chr7B 93.590 390 23 1 56 445 620571839 620572226 4.080000e-162 580
28 TraesCS2B01G022200 chr7B 89.663 445 40 4 2 445 64482487 64482048 1.480000e-156 562


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G022200 chr2B 10667329 10669535 2206 False 4076.000000 4076 100.000000 1 2207 1 chr2B.!!$F1 2206
1 TraesCS2B01G022200 chr2B 390974099 390976306 2207 True 3882.000000 3882 98.415000 1 2207 1 chr2B.!!$R1 2206
2 TraesCS2B01G022200 chr2B 588685237 588687074 1837 True 938.666667 1027 94.155333 630 1989 3 chr2B.!!$R3 1359
3 TraesCS2B01G022200 chr1B 674640421 674642311 1890 True 3260.000000 3260 97.690000 305 2207 1 chr1B.!!$R1 1902
4 TraesCS2B01G022200 chr5A 109299806 109302138 2332 False 1911.500000 3062 97.745500 1 2207 2 chr5A.!!$F1 2206
5 TraesCS2B01G022200 chr2A 130177589 130179919 2330 True 1891.500000 3038 97.295000 1 2207 2 chr2A.!!$R1 2206
6 TraesCS2B01G022200 chr7D 301661113 301662657 1544 True 2124.000000 2124 91.502000 442 1995 1 chr7D.!!$R1 1553
7 TraesCS2B01G022200 chr7D 46096344 46096968 624 False 977.000000 977 94.662000 927 1563 1 chr7D.!!$F2 636
8 TraesCS2B01G022200 chr7D 46101977 46102629 652 False 905.000000 905 91.896000 1563 2207 1 chr7D.!!$F3 644
9 TraesCS2B01G022200 chr1D 252590495 252591726 1231 False 1857.000000 1857 93.845000 967 2207 1 chr1D.!!$F3 1240
10 TraesCS2B01G022200 chr7A 665831109 665832345 1236 True 1829.000000 1829 93.381000 967 2207 1 chr7A.!!$R1 1240
11 TraesCS2B01G022200 chr4A 713136331 713137572 1241 True 1738.000000 1738 92.070000 967 2207 1 chr4A.!!$R1 1240
12 TraesCS2B01G022200 chr6B 26562197 26563057 860 False 1336.000000 1336 94.508000 442 1314 1 chr6B.!!$F1 872
13 TraesCS2B01G022200 chr6A 611533312 611534915 1603 True 803.000000 1225 92.942500 442 2207 2 chr6A.!!$R1 1765

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
526 652 4.101942 CGCTTTGTGTTTGCTTTCTGTAA 58.898 39.13 0.0 0.0 0.0 2.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1922 2162 3.97115 TGCAACAAGTTTATTTGGTCCG 58.029 40.909 0.0 0.0 32.32 4.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
526 652 4.101942 CGCTTTGTGTTTGCTTTCTGTAA 58.898 39.130 0.00 0.0 0.00 2.41
1173 1321 5.695816 GTGTAATTGTGATTTGTGCAATGGT 59.304 36.000 0.00 0.0 33.68 3.55
1755 1985 3.646162 ACTACCAGTCACAACAAGATGGA 59.354 43.478 0.00 0.0 0.00 3.41
1922 2162 1.136000 GCATTCGGCCAAACAATTTGC 60.136 47.619 2.24 0.0 39.31 3.68
2020 2393 7.966204 AGCGGTGTTGTAATATGTAATGTTTTC 59.034 33.333 0.00 0.0 0.00 2.29
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
526 652 3.015327 GACCATTGCTCTGCTTTGAGAT 58.985 45.455 6.22 0.0 36.23 2.75
588 715 0.689623 AGGGCTCACAGGAACTTCTG 59.310 55.000 0.00 0.0 34.60 3.02
1173 1321 2.305927 GACATCCCCTTCCACTCTGAAA 59.694 50.000 0.00 0.0 0.00 2.69
1870 2102 5.121811 ACACATAGGCAAGCTAGAAATCTG 58.878 41.667 0.00 0.0 0.00 2.90
1922 2162 3.971150 TGCAACAAGTTTATTTGGTCCG 58.029 40.909 0.00 0.0 32.32 4.79
2020 2393 8.597167 TGGATAGAATATAGACCAAGTTGATGG 58.403 37.037 3.87 0.0 46.38 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.