Multiple sequence alignment - TraesCS2B01G017400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G017400 chr2B 100.000 6395 0 0 1 6395 8083890 8077496 0.000000e+00 11810
1 TraesCS2B01G017400 chr2B 98.955 6409 51 3 1 6395 8239367 8232961 0.000000e+00 11450
2 TraesCS2B01G017400 chr2B 97.868 4784 80 8 1 4770 7914124 7909349 0.000000e+00 8250
3 TraesCS2B01G017400 chr2B 96.147 2933 90 9 1 2919 7804777 7801854 0.000000e+00 4769
4 TraesCS2B01G017400 chr2B 93.281 3081 176 15 2832 5898 7801856 7798793 0.000000e+00 4514
5 TraesCS2B01G017400 chr2B 99.123 1596 14 0 4800 6395 7909357 7907762 0.000000e+00 2870
6 TraesCS2B01G017400 chr2B 88.081 344 36 2 3599 3942 563087100 563086762 2.780000e-108 403
7 TraesCS2B01G017400 chr2B 87.931 348 35 4 3597 3942 726552340 726552682 2.780000e-108 403
8 TraesCS2B01G017400 chr2B 95.714 210 9 0 6186 6395 7795276 7795067 7.940000e-89 339
9 TraesCS2B01G017400 chr2D 92.510 3832 210 33 135 3911 2889567 2893376 0.000000e+00 5415
10 TraesCS2B01G017400 chr2D 93.453 2444 128 20 3961 6395 2893374 2895794 0.000000e+00 3598
11 TraesCS2B01G017400 chr2D 88.986 345 33 2 3598 3942 598718528 598718867 7.670000e-114 422
12 TraesCS2B01G017400 chr2D 82.955 264 45 0 45 308 493073634 493073371 8.290000e-59 239
13 TraesCS2B01G017400 chr2D 92.806 139 10 0 1 139 2889403 2889541 1.090000e-47 202
14 TraesCS2B01G017400 chr6A 83.690 607 79 11 5791 6393 546622827 546623417 7.240000e-154 555
15 TraesCS2B01G017400 chr6B 81.153 642 95 11 5753 6393 32003801 32004417 5.760000e-135 492
16 TraesCS2B01G017400 chr3A 88.116 345 36 2 3598 3942 701221320 701220981 7.720000e-109 405
17 TraesCS2B01G017400 chr3A 79.692 389 74 3 1997 2381 52727928 52728315 6.320000e-70 276
18 TraesCS2B01G017400 chr3A 79.692 389 74 3 1997 2381 52774228 52774615 6.320000e-70 276
19 TraesCS2B01G017400 chr3A 79.434 389 75 3 1997 2381 52682073 52682460 2.940000e-68 270
20 TraesCS2B01G017400 chr3A 79.177 389 76 3 1997 2381 52589739 52590126 1.370000e-66 265
21 TraesCS2B01G017400 chr3A 79.177 389 76 3 1997 2381 52822120 52822507 1.370000e-66 265
22 TraesCS2B01G017400 chr3A 80.866 277 49 4 5105 5379 52685717 52685991 1.400000e-51 215
23 TraesCS2B01G017400 chr3A 80.797 276 51 2 5105 5379 52826020 52826294 1.400000e-51 215
24 TraesCS2B01G017400 chr3A 80.435 276 52 2 5105 5379 52593563 52593837 6.500000e-50 209
25 TraesCS2B01G017400 chr3A 80.435 276 52 2 5105 5379 52640097 52640371 6.500000e-50 209
26 TraesCS2B01G017400 chr3A 80.435 276 52 2 5105 5379 52731849 52732123 6.500000e-50 209
27 TraesCS2B01G017400 chr3A 75.610 287 62 4 1245 1527 52589255 52589537 1.120000e-27 135
28 TraesCS2B01G017400 chr3A 75.610 287 62 4 1245 1527 52635598 52635880 1.120000e-27 135
29 TraesCS2B01G017400 chr3A 75.610 287 62 4 1245 1527 52681589 52681871 1.120000e-27 135
30 TraesCS2B01G017400 chr3A 75.610 287 62 4 1245 1527 52821636 52821918 1.120000e-27 135
31 TraesCS2B01G017400 chr3A 75.261 287 63 4 1245 1527 52727444 52727726 5.200000e-26 130
32 TraesCS2B01G017400 chr2A 87.679 349 38 2 3597 3945 633949188 633948845 9.990000e-108 401
33 TraesCS2B01G017400 chr2A 82.667 300 46 3 6093 6392 3792037 3791744 1.770000e-65 261
34 TraesCS2B01G017400 chr2A 87.273 165 15 4 350 509 300326698 300326535 3.940000e-42 183
35 TraesCS2B01G017400 chr5D 84.175 297 37 5 5718 6007 48727341 48727634 4.880000e-71 279
36 TraesCS2B01G017400 chr5D 86.301 146 15 4 1 144 90684335 90684477 3.090000e-33 154
37 TraesCS2B01G017400 chr5B 84.014 294 40 4 5718 6007 51332650 51332940 6.320000e-70 276
38 TraesCS2B01G017400 chr5B 87.574 169 15 4 346 509 533382190 533382023 2.350000e-44 191
39 TraesCS2B01G017400 chr7A 83.000 300 45 3 6093 6392 19073670 19073377 3.800000e-67 267
40 TraesCS2B01G017400 chr3B 83.871 279 41 4 6116 6392 731523628 731523904 4.920000e-66 263
41 TraesCS2B01G017400 chr4D 81.818 308 44 9 5718 6021 98857209 98857508 1.380000e-61 248
42 TraesCS2B01G017400 chr1A 79.624 319 63 2 1 318 5612982 5612665 1.790000e-55 228
43 TraesCS2B01G017400 chr1D 87.273 165 16 3 350 509 465958716 465958552 3.940000e-42 183
44 TraesCS2B01G017400 chr1B 85.955 178 17 3 338 509 273653413 273653588 3.940000e-42 183
45 TraesCS2B01G017400 chr4B 85.475 179 18 6 347 519 365625105 365624929 5.090000e-41 180
46 TraesCS2B01G017400 chr7D 86.713 143 19 0 1 143 535948662 535948520 6.640000e-35 159
47 TraesCS2B01G017400 chr7B 85.417 144 21 0 1 144 333712449 333712592 3.990000e-32 150


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G017400 chr2B 8077496 8083890 6394 True 11810.000000 11810 100.000000 1 6395 1 chr2B.!!$R1 6394
1 TraesCS2B01G017400 chr2B 8232961 8239367 6406 True 11450.000000 11450 98.955000 1 6395 1 chr2B.!!$R2 6394
2 TraesCS2B01G017400 chr2B 7907762 7914124 6362 True 5560.000000 8250 98.495500 1 6395 2 chr2B.!!$R5 6394
3 TraesCS2B01G017400 chr2B 7795067 7804777 9710 True 3207.333333 4769 95.047333 1 6395 3 chr2B.!!$R4 6394
4 TraesCS2B01G017400 chr2D 2889403 2895794 6391 False 3071.666667 5415 92.923000 1 6395 3 chr2D.!!$F2 6394
5 TraesCS2B01G017400 chr6A 546622827 546623417 590 False 555.000000 555 83.690000 5791 6393 1 chr6A.!!$F1 602
6 TraesCS2B01G017400 chr6B 32003801 32004417 616 False 492.000000 492 81.153000 5753 6393 1 chr6B.!!$F1 640
7 TraesCS2B01G017400 chr3A 52681589 52685991 4402 False 206.666667 270 78.636667 1245 5379 3 chr3A.!!$F5 4134
8 TraesCS2B01G017400 chr3A 52727444 52732123 4679 False 205.000000 276 78.462667 1245 5379 3 chr3A.!!$F6 4134
9 TraesCS2B01G017400 chr3A 52821636 52826294 4658 False 205.000000 265 78.528000 1245 5379 3 chr3A.!!$F7 4134
10 TraesCS2B01G017400 chr3A 52589255 52593837 4582 False 203.000000 265 78.407333 1245 5379 3 chr3A.!!$F4 4134

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
174 205 0.806868 CGTTGTCAGCCATCATTGCT 59.193 50.000 0.0 0.0 40.41 3.91 F
302 333 2.676822 TGCGAAGAGGAGAGCGGT 60.677 61.111 0.0 0.0 0.00 5.68 F
373 417 6.606241 ACTCCCTCCATTCCCAAATATTTA 57.394 37.500 0.0 0.0 0.00 1.40 F
2829 3722 4.021456 GGTGGAAACATTTTTCGGGATTCT 60.021 41.667 0.0 0.0 46.14 2.40 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1086 1158 1.383943 TGGGGGTGGCTCGTATGAT 60.384 57.895 0.00 0.00 0.00 2.45 R
2154 2232 3.979495 GCAGACTACCATTAACCGATACG 59.021 47.826 0.00 0.00 0.00 3.06 R
2829 3722 4.440103 GTCGCGAATAAAGCTTAGATCGAA 59.560 41.667 23.59 12.49 32.38 3.71 R
5682 8063 7.415765 CCAGAGATGAGCCCTAAAGTATATACG 60.416 44.444 7.23 0.00 0.00 3.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
85 86 5.330455 TGCAGAACAAGAGTAGGAGTATG 57.670 43.478 0.00 0.0 0.00 2.39
174 205 0.806868 CGTTGTCAGCCATCATTGCT 59.193 50.000 0.00 0.0 40.41 3.91
302 333 2.676822 TGCGAAGAGGAGAGCGGT 60.677 61.111 0.00 0.0 0.00 5.68
358 402 9.411189 CAGAATAGGTAGTTATATACTCCCTCC 57.589 40.741 0.00 0.0 38.79 4.30
373 417 6.606241 ACTCCCTCCATTCCCAAATATTTA 57.394 37.500 0.00 0.0 0.00 1.40
2829 3722 4.021456 GGTGGAAACATTTTTCGGGATTCT 60.021 41.667 0.00 0.0 46.14 2.40
2998 3976 2.092968 GTGCCACCATAGAGGAATGTCA 60.093 50.000 0.00 0.0 41.22 3.58
5682 8063 0.377203 GCATTGCTACGGGCTACAAC 59.623 55.000 0.16 0.0 42.39 3.32
6136 8527 4.103311 GTCTTCTCCAATAGGCCCTACAAT 59.897 45.833 0.00 0.0 33.74 2.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
85 86 2.884087 TTCGGCTTCAGATCGCGGTC 62.884 60.000 12.53 12.53 0.00 4.79
154 185 0.799534 GCAATGATGGCTGACAACGC 60.800 55.000 0.00 0.00 0.00 4.84
174 205 2.402564 GATCCCATCTTGGTCTCCTCA 58.597 52.381 0.00 0.00 35.17 3.86
1086 1158 1.383943 TGGGGGTGGCTCGTATGAT 60.384 57.895 0.00 0.00 0.00 2.45
1087 1159 2.039787 TGGGGGTGGCTCGTATGA 59.960 61.111 0.00 0.00 0.00 2.15
2154 2232 3.979495 GCAGACTACCATTAACCGATACG 59.021 47.826 0.00 0.00 0.00 3.06
2829 3722 4.440103 GTCGCGAATAAAGCTTAGATCGAA 59.560 41.667 23.59 12.49 32.38 3.71
2998 3976 6.350445 CCTTTGTATGGCTTCATGTAGCTTTT 60.350 38.462 21.72 10.70 40.99 2.27
5682 8063 7.415765 CCAGAGATGAGCCCTAAAGTATATACG 60.416 44.444 7.23 0.00 0.00 3.06
6136 8527 3.181488 CCAACATGCGCCAATTATCAAGA 60.181 43.478 4.18 0.00 0.00 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.