Multiple sequence alignment - TraesCS2B01G017300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G017300 chr2B 100.000 3577 0 0 1 3577 8072448 8068872 0.000000e+00 6606.0
1 TraesCS2B01G017300 chr2B 99.329 3577 23 1 1 3577 8228202 8224627 0.000000e+00 6471.0
2 TraesCS2B01G017300 chr2B 98.106 1954 25 2 574 2527 7902656 7900715 0.000000e+00 3393.0
3 TraesCS2B01G017300 chr2B 90.570 2036 164 17 574 2595 7837093 7839114 0.000000e+00 2671.0
4 TraesCS2B01G017300 chr2B 92.910 1227 78 6 574 1793 7761869 7763093 0.000000e+00 1775.0
5 TraesCS2B01G017300 chr2B 98.606 574 7 1 2 575 373097471 373096899 0.000000e+00 1014.0
6 TraesCS2B01G017300 chr2B 87.969 773 71 12 1833 2595 7763090 7763850 0.000000e+00 893.0
7 TraesCS2B01G017300 chr2B 95.652 184 8 0 2562 2745 7900718 7900535 2.700000e-76 296.0
8 TraesCS2B01G017300 chr2B 81.955 133 22 2 2784 2916 7763867 7763997 1.050000e-20 111.0
9 TraesCS2B01G017300 chr2A 89.308 2039 174 21 574 2595 2725780 2727791 0.000000e+00 2518.0
10 TraesCS2B01G017300 chr2A 96.546 579 15 4 1 575 50050623 50050046 0.000000e+00 953.0
11 TraesCS2B01G017300 chr2A 95.804 572 24 0 1 572 767550637 767551208 0.000000e+00 924.0
12 TraesCS2B01G017300 chr2A 93.750 80 5 0 2590 2669 566852089 566852168 1.740000e-23 121.0
13 TraesCS2B01G017300 chr2A 81.203 133 23 2 2784 2916 2727808 2727938 4.880000e-19 106.0
14 TraesCS2B01G017300 chr2D 90.304 1939 162 19 575 2501 2949039 2947115 0.000000e+00 2516.0
15 TraesCS2B01G017300 chr2D 96.000 575 23 0 1 575 101335939 101335365 0.000000e+00 935.0
16 TraesCS2B01G017300 chr2D 89.004 482 44 6 3101 3574 127050886 127051366 3.980000e-164 588.0
17 TraesCS2B01G017300 chr2D 94.805 77 4 0 2593 2669 590410633 590410557 1.740000e-23 121.0
18 TraesCS2B01G017300 chr6D 97.217 575 16 0 1 575 433502633 433502059 0.000000e+00 974.0
19 TraesCS2B01G017300 chr6D 84.158 101 16 0 2598 2698 42256988 42257088 8.170000e-17 99.0
20 TraesCS2B01G017300 chr5B 98.198 555 10 0 20 574 318138565 318139119 0.000000e+00 970.0
21 TraesCS2B01G017300 chr5B 93.146 569 38 1 6 574 587458823 587459390 0.000000e+00 833.0
22 TraesCS2B01G017300 chr5B 89.234 483 41 8 3101 3574 145001321 145000841 8.550000e-166 593.0
23 TraesCS2B01G017300 chr5B 82.195 483 82 4 1173 1653 441745050 441745530 2.570000e-111 412.0
24 TraesCS2B01G017300 chr5B 85.882 85 8 4 2704 2784 381355171 381355255 1.770000e-13 87.9
25 TraesCS2B01G017300 chr5B 85.185 81 12 0 2704 2784 689109728 689109808 2.290000e-12 84.2
26 TraesCS2B01G017300 chr3D 78.844 1522 244 45 982 2481 606940935 606942400 0.000000e+00 955.0
27 TraesCS2B01G017300 chr5A 94.539 586 27 4 1 583 97566321 97565738 0.000000e+00 900.0
28 TraesCS2B01G017300 chr5A 89.773 88 6 3 2591 2677 581113084 581112999 3.780000e-20 110.0
29 TraesCS2B01G017300 chr5D 76.267 1243 245 29 1141 2363 371862258 371863470 1.820000e-172 616.0
30 TraesCS2B01G017300 chr5D 88.866 485 39 12 3101 3574 121496919 121497399 1.850000e-162 582.0
31 TraesCS2B01G017300 chr5D 82.000 100 12 4 2704 2799 557034605 557034508 2.960000e-11 80.5
32 TraesCS2B01G017300 chr4D 88.797 482 44 7 3101 3574 385146431 385145952 1.850000e-162 582.0
33 TraesCS2B01G017300 chr4D 88.066 486 48 7 3101 3577 286413294 286412810 5.180000e-158 568.0
34 TraesCS2B01G017300 chr4D 84.545 110 12 2 2593 2697 486775918 486775809 1.760000e-18 104.0
35 TraesCS2B01G017300 chr4D 85.366 82 8 3 2704 2781 420142726 420142645 8.230000e-12 82.4
36 TraesCS2B01G017300 chr1B 88.477 486 45 8 3101 3577 417475784 417475301 8.610000e-161 577.0
37 TraesCS2B01G017300 chr1B 88.211 492 38 16 3101 3577 359300823 359300337 1.440000e-158 569.0
38 TraesCS2B01G017300 chr7B 88.477 486 42 11 3101 3577 55396726 55396246 3.100000e-160 575.0
39 TraesCS2B01G017300 chr7B 85.849 106 10 1 2593 2698 749539838 749539938 1.360000e-19 108.0
40 TraesCS2B01G017300 chr7B 89.744 78 8 0 2704 2781 725690249 725690326 2.270000e-17 100.0
41 TraesCS2B01G017300 chr3B 85.185 108 16 0 2591 2698 5751263 5751156 1.050000e-20 111.0
42 TraesCS2B01G017300 chr3B 98.182 55 1 0 2709 2763 543182191 543182245 2.940000e-16 97.1
43 TraesCS2B01G017300 chr3B 81.818 110 19 1 2590 2698 511379705 511379596 1.370000e-14 91.6
44 TraesCS2B01G017300 chr6B 83.898 118 13 3 2587 2698 561700723 561700606 1.360000e-19 108.0
45 TraesCS2B01G017300 chr6B 82.500 80 10 3 2704 2781 710668876 710668953 2.300000e-07 67.6
46 TraesCS2B01G017300 chr4B 82.143 112 14 4 2589 2698 416641276 416641169 1.370000e-14 91.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G017300 chr2B 8068872 8072448 3576 True 6606.000000 6606 100.000000 1 3577 1 chr2B.!!$R1 3576
1 TraesCS2B01G017300 chr2B 8224627 8228202 3575 True 6471.000000 6471 99.329000 1 3577 1 chr2B.!!$R2 3576
2 TraesCS2B01G017300 chr2B 7837093 7839114 2021 False 2671.000000 2671 90.570000 574 2595 1 chr2B.!!$F1 2021
3 TraesCS2B01G017300 chr2B 7900535 7902656 2121 True 1844.500000 3393 96.879000 574 2745 2 chr2B.!!$R4 2171
4 TraesCS2B01G017300 chr2B 373096899 373097471 572 True 1014.000000 1014 98.606000 2 575 1 chr2B.!!$R3 573
5 TraesCS2B01G017300 chr2B 7761869 7763997 2128 False 926.333333 1775 87.611333 574 2916 3 chr2B.!!$F2 2342
6 TraesCS2B01G017300 chr2A 2725780 2727938 2158 False 1312.000000 2518 85.255500 574 2916 2 chr2A.!!$F3 2342
7 TraesCS2B01G017300 chr2A 50050046 50050623 577 True 953.000000 953 96.546000 1 575 1 chr2A.!!$R1 574
8 TraesCS2B01G017300 chr2A 767550637 767551208 571 False 924.000000 924 95.804000 1 572 1 chr2A.!!$F2 571
9 TraesCS2B01G017300 chr2D 2947115 2949039 1924 True 2516.000000 2516 90.304000 575 2501 1 chr2D.!!$R1 1926
10 TraesCS2B01G017300 chr2D 101335365 101335939 574 True 935.000000 935 96.000000 1 575 1 chr2D.!!$R2 574
11 TraesCS2B01G017300 chr6D 433502059 433502633 574 True 974.000000 974 97.217000 1 575 1 chr6D.!!$R1 574
12 TraesCS2B01G017300 chr5B 318138565 318139119 554 False 970.000000 970 98.198000 20 574 1 chr5B.!!$F1 554
13 TraesCS2B01G017300 chr5B 587458823 587459390 567 False 833.000000 833 93.146000 6 574 1 chr5B.!!$F4 568
14 TraesCS2B01G017300 chr3D 606940935 606942400 1465 False 955.000000 955 78.844000 982 2481 1 chr3D.!!$F1 1499
15 TraesCS2B01G017300 chr5A 97565738 97566321 583 True 900.000000 900 94.539000 1 583 1 chr5A.!!$R1 582
16 TraesCS2B01G017300 chr5D 371862258 371863470 1212 False 616.000000 616 76.267000 1141 2363 1 chr5D.!!$F2 1222

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
409 411 5.762179 ATGTTTTCATCACTGTCCTAGGA 57.238 39.13 7.62 7.62 35.32 2.94 F
2343 2388 0.911769 CATGTCAAGGGGAGCCTACA 59.088 55.00 0.00 0.00 0.00 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2343 2388 0.842030 TCCAGGTCCCTGCAGTTGAT 60.842 55.0 13.81 0.0 42.35 2.57 R
3440 3489 0.977395 ACTACTTTGCTTCGAGGGCT 59.023 50.0 12.40 0.0 0.00 5.19 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
409 411 5.762179 ATGTTTTCATCACTGTCCTAGGA 57.238 39.13 7.62 7.62 35.32 2.94
2343 2388 0.911769 CATGTCAAGGGGAGCCTACA 59.088 55.00 0.00 0.00 0.00 2.74
2543 2592 7.532682 TTTGAATTAGCGGCAAAATATTTCC 57.467 32.00 1.45 0.00 0.00 3.13
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
715 721 5.437060 TCCTCAGGTAATGTCTTTTATGCC 58.563 41.667 0.00 0.0 0.00 4.40
1268 1280 2.786495 CCTCATAGTCGTGCCCGCT 61.786 63.158 0.00 0.0 0.00 5.52
2189 2231 1.525306 GCTATACAACACCCCGGCC 60.525 63.158 0.00 0.0 0.00 6.13
2343 2388 0.842030 TCCAGGTCCCTGCAGTTGAT 60.842 55.000 13.81 0.0 42.35 2.57
2543 2592 9.567848 ACAACAATTAATTAGGATGCTTTAACG 57.432 29.630 0.00 0.0 0.00 3.18
3440 3489 0.977395 ACTACTTTGCTTCGAGGGCT 59.023 50.000 12.40 0.0 0.00 5.19
3549 3598 1.813859 CGGTGAGGTCGGAGCATAA 59.186 57.895 10.15 0.0 0.00 1.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.