Multiple sequence alignment - TraesCS2B01G017100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G017100 chr2B 100.000 2255 0 0 1 2255 7913843 7911589 0.000000e+00 4165
1 TraesCS2B01G017100 chr2B 98.758 2255 27 1 1 2255 8239086 8236833 0.000000e+00 4008
2 TraesCS2B01G017100 chr2B 97.563 2257 39 3 1 2255 8083609 8081367 0.000000e+00 3849
3 TraesCS2B01G017100 chr2B 96.144 2256 78 8 1 2255 7804496 7802249 0.000000e+00 3675
4 TraesCS2B01G017100 chr2B 88.757 169 13 5 79 241 751258291 751258459 3.800000e-48 202
5 TraesCS2B01G017100 chr2D 92.187 2291 125 28 3 2254 2889716 2891991 0.000000e+00 3190
6 TraesCS2B01G017100 chr2D 89.697 165 11 4 82 241 431209710 431209873 2.940000e-49 206
7 TraesCS2B01G017100 chr3A 79.540 391 72 6 1727 2112 52727928 52728315 2.850000e-69 272
8 TraesCS2B01G017100 chr3A 79.540 391 72 6 1727 2112 52774228 52774615 2.850000e-69 272
9 TraesCS2B01G017100 chr3A 79.284 391 73 6 1727 2112 52682073 52682460 1.330000e-67 267
10 TraesCS2B01G017100 chr3A 79.028 391 74 6 1727 2112 52589739 52590126 6.180000e-66 261
11 TraesCS2B01G017100 chr3A 79.028 391 74 6 1727 2112 52822120 52822507 6.180000e-66 261
12 TraesCS2B01G017100 chr3A 77.352 287 57 4 975 1257 52589255 52589537 1.790000e-36 163
13 TraesCS2B01G017100 chr3A 77.352 287 57 4 975 1257 52635598 52635880 1.790000e-36 163
14 TraesCS2B01G017100 chr3A 77.352 287 57 4 975 1257 52681589 52681871 1.790000e-36 163
15 TraesCS2B01G017100 chr3A 77.352 287 57 4 975 1257 52821636 52821918 1.790000e-36 163
16 TraesCS2B01G017100 chr3A 77.003 287 58 4 975 1257 52727444 52727726 8.340000e-35 158
17 TraesCS2B01G017100 chr6D 89.412 170 11 4 78 241 455574936 455575104 8.160000e-50 207
18 TraesCS2B01G017100 chr1D 89.157 166 12 4 82 242 463000157 462999993 3.800000e-48 202
19 TraesCS2B01G017100 chr1B 87.640 178 14 3 70 241 273653413 273653588 1.370000e-47 200


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G017100 chr2B 7911589 7913843 2254 True 4165 4165 100.0000 1 2255 1 chr2B.!!$R2 2254
1 TraesCS2B01G017100 chr2B 8236833 8239086 2253 True 4008 4008 98.7580 1 2255 1 chr2B.!!$R4 2254
2 TraesCS2B01G017100 chr2B 8081367 8083609 2242 True 3849 3849 97.5630 1 2255 1 chr2B.!!$R3 2254
3 TraesCS2B01G017100 chr2B 7802249 7804496 2247 True 3675 3675 96.1440 1 2255 1 chr2B.!!$R1 2254
4 TraesCS2B01G017100 chr2D 2889716 2891991 2275 False 3190 3190 92.1870 3 2254 1 chr2D.!!$F1 2251
5 TraesCS2B01G017100 chr3A 52681589 52682460 871 False 215 267 78.3180 975 2112 2 chr3A.!!$F4 1137
6 TraesCS2B01G017100 chr3A 52727444 52728315 871 False 215 272 78.2715 975 2112 2 chr3A.!!$F5 1137
7 TraesCS2B01G017100 chr3A 52589255 52590126 871 False 212 261 78.1900 975 2112 2 chr3A.!!$F3 1137
8 TraesCS2B01G017100 chr3A 52821636 52822507 871 False 212 261 78.1900 975 2112 2 chr3A.!!$F6 1137

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
805 835 1.488705 TTTGAGCCCTCGTCATGGGT 61.489 55.0 0.0 0.0 46.22 4.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1933 2026 0.178767 AGTGCTCTATGAATGGCGCA 59.821 50.0 10.83 0.0 37.62 6.09 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
284 294 2.308570 TCCACATACATTTGAGGTGCCT 59.691 45.455 0.0 0.0 0.00 4.75
392 402 3.350833 ACGGGTAAGAGACGTACAGAAT 58.649 45.455 0.0 0.0 39.30 2.40
583 593 4.718858 CGATGTTCGTGTAGTCCAAAAA 57.281 40.909 0.0 0.0 34.72 1.94
805 835 1.488705 TTTGAGCCCTCGTCATGGGT 61.489 55.000 0.0 0.0 46.22 4.51
891 921 5.638234 GGTTTAGAACTTCTCATAAGCACGT 59.362 40.000 0.0 0.0 0.00 4.49
1158 1197 7.617225 TCCATGACTCTTTAAACGAAATCCTA 58.383 34.615 0.0 0.0 0.00 2.94
1859 1949 2.952310 GTGAGCCAAAACTGGAAGAAGT 59.048 45.455 0.0 0.0 37.43 3.01
1933 2026 3.372025 CCCCCTAGCTAAGCAAGTCAAAT 60.372 47.826 0.0 0.0 0.00 2.32
1974 2067 1.229400 AAGGGCGGTGTAAGAGGGA 60.229 57.895 0.0 0.0 0.00 4.20
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
284 294 4.395854 CAGCCACAGCACATTACTTAATCA 59.604 41.667 0.00 0.00 43.56 2.57
411 421 2.271800 GAATGCGTGAGAGACCGAAAT 58.728 47.619 0.00 0.00 0.00 2.17
718 748 1.323412 CGCCATGAGAGGTAGCTAGT 58.677 55.000 0.00 0.00 0.00 2.57
805 835 4.435518 GCTCGTATGCGATGAAAAAGTCAA 60.436 41.667 6.30 0.00 46.80 3.18
891 921 2.933495 AGAAGATTGCGTGCGTAGTA 57.067 45.000 0.00 0.00 0.00 1.82
1158 1197 5.592688 GGATGAGCTACTAAAGTCACTCTCT 59.407 44.000 11.45 2.73 33.66 3.10
1859 1949 2.975732 TTGCCTTGCAAAACACATGA 57.024 40.000 0.00 0.00 45.96 3.07
1933 2026 0.178767 AGTGCTCTATGAATGGCGCA 59.821 50.000 10.83 0.00 37.62 6.09
1963 2056 0.460459 GCGCTTCCTCCCTCTTACAC 60.460 60.000 0.00 0.00 0.00 2.90
1974 2067 6.759272 TCTGAAATATATTGTAGCGCTTCCT 58.241 36.000 18.68 3.03 0.00 3.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.