Multiple sequence alignment - TraesCS2B01G015100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G015100 chr2B 100.000 3005 0 0 1 3005 7107878 7110882 0.000000e+00 5550
1 TraesCS2B01G015100 chr2B 98.131 3049 13 3 1 3005 7066165 7069213 0.000000e+00 5275
2 TraesCS2B01G015100 chr2B 97.278 3049 38 4 1 3005 7027475 7030522 0.000000e+00 5129
3 TraesCS2B01G015100 chr2B 97.020 3054 42 6 1 3005 454768729 454765676 0.000000e+00 5090
4 TraesCS2B01G015100 chr2B 91.801 2976 168 30 85 3005 6987933 6984979 0.000000e+00 4074
5 TraesCS2B01G015100 chr2B 97.597 1623 9 2 1 1593 454742248 454740626 0.000000e+00 2754
6 TraesCS2B01G015100 chr2B 95.742 869 18 4 2156 3005 454740126 454739258 0.000000e+00 1382
7 TraesCS2B01G015100 chr2B 90.265 226 22 0 856 1081 6988692 6988467 2.270000e-76 296
8 TraesCS2B01G015100 chr2A 88.501 1261 116 17 1162 2419 6293287 6292053 0.000000e+00 1498
9 TraesCS2B01G015100 chr2A 87.402 508 64 0 538 1045 6293842 6293335 4.320000e-163 584
10 TraesCS2B01G015100 chr2A 90.909 253 21 2 2754 3005 6291707 6291456 3.710000e-89 339
11 TraesCS2B01G015100 chrUn 84.880 1250 116 29 1808 3005 11587011 11585783 0.000000e+00 1194
12 TraesCS2B01G015100 chr1D 79.042 1336 220 35 687 1985 490431017 490429705 0.000000e+00 861
13 TraesCS2B01G015100 chr3D 82.234 197 27 5 146 341 589577921 589577732 2.400000e-36 163
14 TraesCS2B01G015100 chr6B 83.240 179 23 4 164 341 481042849 481043021 1.120000e-34 158
15 TraesCS2B01G015100 chr5A 82.081 173 24 5 169 340 689612524 689612358 1.120000e-29 141
16 TraesCS2B01G015100 chr7D 80.100 201 28 8 147 342 152134103 152133910 4.040000e-29 139


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G015100 chr2B 7107878 7110882 3004 False 5550 5550 100.000000 1 3005 1 chr2B.!!$F3 3004
1 TraesCS2B01G015100 chr2B 7066165 7069213 3048 False 5275 5275 98.131000 1 3005 1 chr2B.!!$F2 3004
2 TraesCS2B01G015100 chr2B 7027475 7030522 3047 False 5129 5129 97.278000 1 3005 1 chr2B.!!$F1 3004
3 TraesCS2B01G015100 chr2B 454765676 454768729 3053 True 5090 5090 97.020000 1 3005 1 chr2B.!!$R1 3004
4 TraesCS2B01G015100 chr2B 6984979 6988692 3713 True 2185 4074 91.033000 85 3005 2 chr2B.!!$R2 2920
5 TraesCS2B01G015100 chr2B 454739258 454742248 2990 True 2068 2754 96.669500 1 3005 2 chr2B.!!$R3 3004
6 TraesCS2B01G015100 chr2A 6291456 6293842 2386 True 807 1498 88.937333 538 3005 3 chr2A.!!$R1 2467
7 TraesCS2B01G015100 chrUn 11585783 11587011 1228 True 1194 1194 84.880000 1808 3005 1 chrUn.!!$R1 1197
8 TraesCS2B01G015100 chr1D 490429705 490431017 1312 True 861 861 79.042000 687 1985 1 chr1D.!!$R1 1298

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
825 1572 0.616111 AGAACATCACCTCCGCTCCT 60.616 55.0 0.0 0.0 0.0 3.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2836 3681 5.529289 TCTATCACCAATTCACCTACCTCT 58.471 41.667 0.0 0.0 0.0 3.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
825 1572 0.616111 AGAACATCACCTCCGCTCCT 60.616 55.000 0.0 0.0 0.0 3.69
2420 3212 7.602265 CCATTAAAAACACTTTGTCAATAGGGG 59.398 37.037 0.0 0.0 0.0 4.79
2836 3681 7.067372 CCCTAAAATCTGAGCATGTTGACAATA 59.933 37.037 0.0 0.0 0.0 1.90
2851 3696 6.878923 TGTTGACAATAGAGGTAGGTGAATTG 59.121 38.462 0.0 0.0 0.0 2.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
137 814 2.905085 TGACCCAAAATACGGTGACCTA 59.095 45.455 0.00 0.0 30.56 3.08
825 1572 2.048597 CGCCAGTGCTCACCGTAA 60.049 61.111 0.00 0.0 34.43 3.18
2836 3681 5.529289 TCTATCACCAATTCACCTACCTCT 58.471 41.667 0.00 0.0 0.00 3.69
2851 3696 9.892130 TTATTTTCTTCTTCCTCTTCTATCACC 57.108 33.333 0.00 0.0 0.00 4.02
2965 3810 7.416154 TTTACTAAGACGATCACTTTGGTTG 57.584 36.000 7.32 0.0 0.00 3.77


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.