Multiple sequence alignment - TraesCS2B01G015000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G015000 chr2B 100.000 2883 0 0 1 2883 7082943 7080061 0.000000e+00 5325
1 TraesCS2B01G015000 chr2B 98.892 2889 26 3 1 2883 7157191 7154303 0.000000e+00 5153
2 TraesCS2B01G015000 chr2B 98.891 2886 27 3 1 2883 7124626 7121743 0.000000e+00 5147
3 TraesCS2B01G015000 chr2B 98.719 2888 32 4 1 2883 454724711 454727598 0.000000e+00 5123
4 TraesCS2B01G015000 chr2B 98.238 2895 39 5 1 2883 7044134 7041240 0.000000e+00 5053
5 TraesCS2B01G015000 chr2B 98.203 2893 31 5 1 2883 454788846 454791727 0.000000e+00 5035
6 TraesCS2B01G015000 chr2B 96.417 2540 85 5 1 2536 6960851 6963388 0.000000e+00 4181
7 TraesCS2B01G015000 chr2B 98.410 2075 21 3 821 2883 454752205 454754279 0.000000e+00 3639
8 TraesCS2B01G015000 chr2B 96.611 1859 60 3 1 1857 6874893 6876750 0.000000e+00 3081
9 TraesCS2B01G015000 chr2B 95.077 325 16 0 2559 2883 6885006 6885330 1.980000e-141 512
10 TraesCS2B01G015000 chr2B 94.769 325 17 0 2559 2883 6965416 6965740 9.220000e-140 507
11 TraesCS2B01G015000 chr2D 89.675 2431 165 41 63 2466 4030820 4033191 0.000000e+00 3020
12 TraesCS2B01G015000 chrUn 98.571 1120 14 2 1 1118 268875573 268876692 0.000000e+00 1978
13 TraesCS2B01G015000 chrUn 98.775 1061 10 2 1826 2883 437498901 437497841 0.000000e+00 1884
14 TraesCS2B01G015000 chrUn 96.029 680 24 2 1859 2536 332137353 332138031 0.000000e+00 1103


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G015000 chr2B 7080061 7082943 2882 True 5325 5325 100.000 1 2883 1 chr2B.!!$R2 2882
1 TraesCS2B01G015000 chr2B 7154303 7157191 2888 True 5153 5153 98.892 1 2883 1 chr2B.!!$R4 2882
2 TraesCS2B01G015000 chr2B 7121743 7124626 2883 True 5147 5147 98.891 1 2883 1 chr2B.!!$R3 2882
3 TraesCS2B01G015000 chr2B 454724711 454727598 2887 False 5123 5123 98.719 1 2883 1 chr2B.!!$F3 2882
4 TraesCS2B01G015000 chr2B 7041240 7044134 2894 True 5053 5053 98.238 1 2883 1 chr2B.!!$R1 2882
5 TraesCS2B01G015000 chr2B 454788846 454791727 2881 False 5035 5035 98.203 1 2883 1 chr2B.!!$F5 2882
6 TraesCS2B01G015000 chr2B 454752205 454754279 2074 False 3639 3639 98.410 821 2883 1 chr2B.!!$F4 2062
7 TraesCS2B01G015000 chr2B 6874893 6876750 1857 False 3081 3081 96.611 1 1857 1 chr2B.!!$F1 1856
8 TraesCS2B01G015000 chr2B 6960851 6965740 4889 False 2344 4181 95.593 1 2883 2 chr2B.!!$F6 2882
9 TraesCS2B01G015000 chr2D 4030820 4033191 2371 False 3020 3020 89.675 63 2466 1 chr2D.!!$F1 2403
10 TraesCS2B01G015000 chrUn 268875573 268876692 1119 False 1978 1978 98.571 1 1118 1 chrUn.!!$F1 1117
11 TraesCS2B01G015000 chrUn 437497841 437498901 1060 True 1884 1884 98.775 1826 2883 1 chrUn.!!$R1 1057
12 TraesCS2B01G015000 chrUn 332137353 332138031 678 False 1103 1103 96.029 1859 2536 1 chrUn.!!$F2 677

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
689 707 1.821241 CTCAGCAACGACGTGGTGTG 61.821 60.0 20.72 16.93 45.23 3.82 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2294 2327 4.950744 GCTGCTTGCACGTTTGAT 57.049 50.0 0.0 0.0 42.31 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
251 268 2.593978 CTCCTGGGCCATGGACTG 59.406 66.667 19.55 10.90 0.00 3.51
372 390 1.952102 GCGAGGTCCCAACGGTGATA 61.952 60.000 0.00 0.00 0.00 2.15
689 707 1.821241 CTCAGCAACGACGTGGTGTG 61.821 60.000 20.72 16.93 45.23 3.82
1346 1370 4.209866 ATCCCGAAGCCATGGCCC 62.210 66.667 33.14 23.07 43.17 5.80
2294 2327 2.278849 CCAAGCATTCATGGGTGCA 58.721 52.632 20.29 0.00 43.63 4.57
2781 4839 3.938963 CCTAACTCAAAGAAGGCGCATTA 59.061 43.478 7.54 0.00 0.00 1.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
251 268 0.253327 AGGCTTCCGATGAAGGGAAC 59.747 55.000 4.64 0.0 46.68 3.62
449 467 1.078918 CAGCCGAAGATGTCCAGCA 60.079 57.895 0.00 0.0 0.00 4.41
522 540 0.610232 GCTCCATGGTGCAGACCTTT 60.610 55.000 29.33 0.0 43.58 3.11
904 922 2.427320 GTCCTGTGTGGCAGCTCA 59.573 61.111 0.00 0.0 43.71 4.26
1346 1370 2.864946 CTCGGATCTCAATCTGTGCTTG 59.135 50.000 0.00 0.0 39.06 4.01
2193 2226 5.184892 AGCAGTACATCTTCCAAAAGGAT 57.815 39.130 0.00 0.0 33.03 3.24
2294 2327 4.950744 GCTGCTTGCACGTTTGAT 57.049 50.000 0.00 0.0 42.31 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.