Multiple sequence alignment - TraesCS2B01G014900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G014900 chr2B 100.000 3968 0 0 1 3968 7065628 7069595 0.000000e+00 7328
1 TraesCS2B01G014900 chr2B 98.942 3968 41 1 1 3968 7026938 7030904 0.000000e+00 7094
2 TraesCS2B01G014900 chr2B 98.691 3973 47 3 1 3968 454769266 454765294 0.000000e+00 7044
3 TraesCS2B01G014900 chr2B 98.412 3968 18 4 1 3968 7107342 7111264 0.000000e+00 6937
4 TraesCS2B01G014900 chr2B 93.520 3364 174 21 622 3968 6987933 6984597 0.000000e+00 4964
5 TraesCS2B01G014900 chr2B 99.167 2160 17 1 1 2159 454742785 454740626 0.000000e+00 3888
6 TraesCS2B01G014900 chr2B 98.321 1251 17 2 2722 3968 454740126 454738876 0.000000e+00 2191
7 TraesCS2B01G014900 chr2B 99.644 281 1 0 3688 3968 7124819 7125099 7.600000e-142 514
8 TraesCS2B01G014900 chr2B 90.708 226 21 0 1422 1647 6988692 6988467 6.440000e-78 302
9 TraesCS2B01G014900 chr2B 86.928 153 19 1 353 505 426824568 426824719 1.900000e-38 171
10 TraesCS2B01G014900 chr2A 88.226 1274 121 17 1728 2998 6293287 6292040 0.000000e+00 1495
11 TraesCS2B01G014900 chr2A 86.726 678 83 4 935 1611 6294006 6293335 0.000000e+00 747
12 TraesCS2B01G014900 chr2A 92.188 256 18 2 3335 3589 6291707 6291453 1.050000e-95 361
13 TraesCS2B01G014900 chrUn 86.034 1253 117 27 2374 3589 11587011 11585780 0.000000e+00 1291
14 TraesCS2B01G014900 chrUn 91.123 383 33 1 3587 3968 11590466 11590084 5.880000e-143 518
15 TraesCS2B01G014900 chr1D 79.117 1336 219 35 1253 2551 490431017 490429705 0.000000e+00 867
16 TraesCS2B01G014900 chr5B 79.600 250 50 1 351 600 106360919 106360671 1.130000e-40 178
17 TraesCS2B01G014900 chr7A 85.526 152 21 1 351 502 1278670 1278820 1.480000e-34 158
18 TraesCS2B01G014900 chr7A 89.000 100 11 0 1 100 261847399 261847300 1.500000e-24 124
19 TraesCS2B01G014900 chr7A 88.776 98 8 3 1 97 581028139 581028234 2.510000e-22 117
20 TraesCS2B01G014900 chr4D 85.526 152 20 2 351 502 106669007 106668858 1.480000e-34 158
21 TraesCS2B01G014900 chr4D 89.691 97 10 0 1 97 118723205 118723109 1.500000e-24 124
22 TraesCS2B01G014900 chr3D 81.726 197 28 5 683 878 589577921 589577732 1.480000e-34 158
23 TraesCS2B01G014900 chr3D 84.516 155 24 0 351 505 169725135 169725289 1.910000e-33 154
24 TraesCS2B01G014900 chr6B 82.682 179 24 4 701 878 481042849 481043021 6.870000e-33 152
25 TraesCS2B01G014900 chr5A 82.184 174 22 7 706 877 689612524 689612358 1.490000e-29 141
26 TraesCS2B01G014900 chr7D 79.500 200 31 6 684 879 152134103 152133910 2.490000e-27 134
27 TraesCS2B01G014900 chr7D 87.629 97 12 0 1 97 291522232 291522328 3.240000e-21 113
28 TraesCS2B01G014900 chr1A 89.583 96 10 0 4 99 576870135 576870040 5.380000e-24 122


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G014900 chr2B 7065628 7069595 3967 False 7328.000000 7328 100.000000 1 3968 1 chr2B.!!$F2 3967
1 TraesCS2B01G014900 chr2B 7026938 7030904 3966 False 7094.000000 7094 98.942000 1 3968 1 chr2B.!!$F1 3967
2 TraesCS2B01G014900 chr2B 454765294 454769266 3972 True 7044.000000 7044 98.691000 1 3968 1 chr2B.!!$R1 3967
3 TraesCS2B01G014900 chr2B 7107342 7111264 3922 False 6937.000000 6937 98.412000 1 3968 1 chr2B.!!$F3 3967
4 TraesCS2B01G014900 chr2B 454738876 454742785 3909 True 3039.500000 3888 98.744000 1 3968 2 chr2B.!!$R3 3967
5 TraesCS2B01G014900 chr2B 6984597 6988692 4095 True 2633.000000 4964 92.114000 622 3968 2 chr2B.!!$R2 3346
6 TraesCS2B01G014900 chr2A 6291453 6294006 2553 True 867.666667 1495 89.046667 935 3589 3 chr2A.!!$R1 2654
7 TraesCS2B01G014900 chrUn 11585780 11590466 4686 True 904.500000 1291 88.578500 2374 3968 2 chrUn.!!$R1 1594
8 TraesCS2B01G014900 chr1D 490429705 490431017 1312 True 867.000000 867 79.117000 1253 2551 1 chr1D.!!$R1 1298

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
440 442 1.196581 CGTGACAACCGCAATCAATCA 59.803 47.619 0.0 0.0 0.0 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3678 4802 3.992943 AATTCTTCGGTGTCCCACATA 57.007 42.857 0.0 0.0 35.86 2.29 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
440 442 1.196581 CGTGACAACCGCAATCAATCA 59.803 47.619 0.00 0.0 0.00 2.57
1003 1155 2.301346 CATCCCCTGTATCAGCCAAAC 58.699 52.381 0.00 0.0 0.00 2.93
1735 1895 4.386049 GCTCATTTATCGTAATCGGTGGAG 59.614 45.833 0.00 0.0 37.69 3.86
3678 4802 3.664107 AGTGTATGAACATGCGTGAAGT 58.336 40.909 14.17 0.0 38.08 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
440 442 3.508793 CCTGCATGGAGAGAAATTTGTGT 59.491 43.478 16.85 0.0 38.35 3.72
3678 4802 3.992943 AATTCTTCGGTGTCCCACATA 57.007 42.857 0.00 0.0 35.86 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.