Multiple sequence alignment - TraesCS2B01G014600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G014600 chr2B 100.000 5015 0 0 1 5015 6959822 6954808 0.000000e+00 9262.0
1 TraesCS2B01G014600 chr2B 97.341 3122 75 6 940 4055 454694491 454691372 0.000000e+00 5299.0
2 TraesCS2B01G014600 chr2B 96.500 3143 104 5 918 4055 454720479 454717338 0.000000e+00 5190.0
3 TraesCS2B01G014600 chr2B 96.504 2603 82 7 918 3513 7086326 7088926 0.000000e+00 4294.0
4 TraesCS2B01G014600 chr2B 95.774 2603 86 15 918 3513 7160575 7163160 0.000000e+00 4176.0
5 TraesCS2B01G014600 chr2B 96.426 2350 67 7 1552 3898 7000942 7003277 0.000000e+00 3858.0
6 TraesCS2B01G014600 chr2B 99.607 2037 7 1 1898 3934 6871299 6869264 0.000000e+00 3716.0
7 TraesCS2B01G014600 chr2B 99.536 1940 9 0 1 1940 6873238 6871299 0.000000e+00 3533.0
8 TraesCS2B01G014600 chr2B 95.736 1407 52 5 918 2318 7048515 7049919 0.000000e+00 2259.0
9 TraesCS2B01G014600 chr2B 97.228 938 26 0 4078 5015 454691381 454690444 0.000000e+00 1589.0
10 TraesCS2B01G014600 chr2B 96.695 938 31 0 4078 5015 7003715 7004652 0.000000e+00 1561.0
11 TraesCS2B01G014600 chr2B 96.482 938 33 0 4078 5015 454717347 454716410 0.000000e+00 1550.0
12 TraesCS2B01G014600 chr2B 93.649 929 51 3 4091 5015 6998066 6997142 0.000000e+00 1382.0
13 TraesCS2B01G014600 chr2B 99.704 676 2 0 4340 5015 6867183 6866508 0.000000e+00 1238.0
14 TraesCS2B01G014600 chr2B 89.893 841 40 10 91 906 454695306 454694486 0.000000e+00 1040.0
15 TraesCS2B01G014600 chr2B 95.155 516 25 0 3542 4057 6998579 6998064 0.000000e+00 815.0
16 TraesCS2B01G014600 chr2B 100.000 431 0 0 1 431 6877191 6876761 0.000000e+00 797.0
17 TraesCS2B01G014600 chr2B 94.309 369 1 1 3945 4293 6867544 6867176 9.490000e-152 547.0
18 TraesCS2B01G014600 chr2B 89.157 415 22 7 29 420 454788493 454788079 3.490000e-136 496.0
19 TraesCS2B01G014600 chr2B 88.916 415 23 7 29 420 7157544 7157958 1.620000e-134 490.0
20 TraesCS2B01G014600 chr2B 88.916 415 23 7 29 420 454724358 454723944 1.620000e-134 490.0
21 TraesCS2B01G014600 chr2B 88.675 415 24 2 29 420 7044487 7044901 7.550000e-133 484.0
22 TraesCS2B01G014600 chr2B 79.967 614 119 4 3381 3992 7579152 7579763 2.750000e-122 449.0
23 TraesCS2B01G014600 chr2B 97.087 103 3 0 766 868 7048411 7048513 1.860000e-39 174.0
24 TraesCS2B01G014600 chr2B 97.087 103 3 0 766 868 454720583 454720481 1.860000e-39 174.0
25 TraesCS2B01G014600 chr2B 97.087 103 3 0 766 868 454784712 454784610 1.860000e-39 174.0
26 TraesCS2B01G014600 chr2B 96.117 103 4 0 766 868 7160471 7160573 8.630000e-38 169.0
27 TraesCS2B01G014600 chr2B 96.250 80 3 0 1343 1422 454784260 454784181 1.130000e-26 132.0
28 TraesCS2B01G014600 chr2D 95.106 1880 82 9 2161 4035 4027132 4025258 0.000000e+00 2953.0
29 TraesCS2B01G014600 chr2D 94.899 1882 83 10 2161 4036 3969540 3967666 0.000000e+00 2931.0
30 TraesCS2B01G014600 chr2D 89.782 2202 136 26 3 2166 4030544 4028394 0.000000e+00 2737.0
31 TraesCS2B01G014600 chr2D 89.550 2201 139 27 3 2166 3972945 3970799 0.000000e+00 2706.0
32 TraesCS2B01G014600 chr2D 91.949 708 36 3 4116 4802 3967284 3966577 0.000000e+00 972.0
33 TraesCS2B01G014600 chr2D 91.938 707 37 2 4116 4802 4024876 4024170 0.000000e+00 972.0
34 TraesCS2B01G014600 chr2D 94.037 218 9 2 4798 5015 3965119 3964906 1.350000e-85 327.0
35 TraesCS2B01G014600 chr2D 93.119 218 11 2 4798 5015 4022518 4022305 2.910000e-82 316.0
36 TraesCS2B01G014600 chrUn 93.277 1175 73 5 2884 4057 11589951 11588782 0.000000e+00 1727.0
37 TraesCS2B01G014600 chrUn 96.591 440 14 1 918 1357 268871349 268870911 0.000000e+00 728.0
38 TraesCS2B01G014600 chrUn 100.000 323 0 0 4693 5015 348447257 348446935 9.290000e-167 597.0
39 TraesCS2B01G014600 chrUn 82.353 697 78 24 193 872 11581209 11581877 9.430000e-157 564.0
40 TraesCS2B01G014600 chrUn 82.353 697 78 27 193 872 440301147 440300479 9.430000e-157 564.0
41 TraesCS2B01G014600 chrUn 89.157 415 22 7 29 420 360049893 360049479 3.490000e-136 496.0
42 TraesCS2B01G014600 chrUn 88.675 415 24 2 29 420 268875220 268874806 7.550000e-133 484.0
43 TraesCS2B01G014600 chrUn 89.855 207 18 1 4253 4456 398109863 398110069 3.850000e-66 263.0
44 TraesCS2B01G014600 chrUn 89.855 207 18 1 4253 4456 468075067 468075273 3.850000e-66 263.0
45 TraesCS2B01G014600 chrUn 89.326 178 18 1 4076 4252 11588793 11588616 6.530000e-54 222.0
46 TraesCS2B01G014600 chrUn 97.087 103 3 0 766 868 385833008 385833110 1.860000e-39 174.0
47 TraesCS2B01G014600 chr2A 77.124 153 28 5 374 522 44108033 44108182 1.160000e-11 82.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G014600 chr2B 6954808 6959822 5014 True 9262.000000 9262 100.000000 1 5015 1 chr2B.!!$R1 5014
1 TraesCS2B01G014600 chr2B 7086326 7088926 2600 False 4294.000000 4294 96.504000 918 3513 1 chr2B.!!$F1 2595
2 TraesCS2B01G014600 chr2B 7000942 7004652 3710 False 2709.500000 3858 96.560500 1552 5015 2 chr2B.!!$F3 3463
3 TraesCS2B01G014600 chr2B 454690444 454695306 4862 True 2642.666667 5299 94.820667 91 5015 3 chr2B.!!$R4 4924
4 TraesCS2B01G014600 chr2B 6866508 6877191 10683 True 1966.200000 3716 98.631200 1 5015 5 chr2B.!!$R2 5014
5 TraesCS2B01G014600 chr2B 454716410 454724358 7948 True 1851.000000 5190 94.746250 29 5015 4 chr2B.!!$R5 4986
6 TraesCS2B01G014600 chr2B 7157544 7163160 5616 False 1611.666667 4176 93.602333 29 3513 3 chr2B.!!$F5 3484
7 TraesCS2B01G014600 chr2B 6997142 6998579 1437 True 1098.500000 1382 94.402000 3542 5015 2 chr2B.!!$R3 1473
8 TraesCS2B01G014600 chr2B 7044487 7049919 5432 False 972.333333 2259 93.832667 29 2318 3 chr2B.!!$F4 2289
9 TraesCS2B01G014600 chr2B 7579152 7579763 611 False 449.000000 449 79.967000 3381 3992 1 chr2B.!!$F2 611
10 TraesCS2B01G014600 chr2B 454784181 454788493 4312 True 267.333333 496 94.164667 29 1422 3 chr2B.!!$R6 1393
11 TraesCS2B01G014600 chr2D 4022305 4030544 8239 True 1744.500000 2953 92.486250 3 5015 4 chr2D.!!$R2 5012
12 TraesCS2B01G014600 chr2D 3964906 3972945 8039 True 1734.000000 2931 92.608750 3 5015 4 chr2D.!!$R1 5012
13 TraesCS2B01G014600 chrUn 11588616 11589951 1335 True 974.500000 1727 91.301500 2884 4252 2 chrUn.!!$R4 1368
14 TraesCS2B01G014600 chrUn 268870911 268875220 4309 True 606.000000 728 92.633000 29 1357 2 chrUn.!!$R5 1328
15 TraesCS2B01G014600 chrUn 11581209 11581877 668 False 564.000000 564 82.353000 193 872 1 chrUn.!!$F1 679
16 TraesCS2B01G014600 chrUn 440300479 440301147 668 True 564.000000 564 82.353000 193 872 1 chrUn.!!$R3 679

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1859 9083 5.677344 GCTCAGACTACAGAACGATGATTCA 60.677 44.000 0.00 0.00 0.0 2.57 F
3106 11647 6.230849 TGAATGTCTCATTTTTGCAATTGC 57.769 33.333 23.69 23.69 42.5 3.56 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3106 11647 4.815269 ACAGAGAAAGAGGTGAAAGATCG 58.185 43.478 0.0 0.0 0.0 3.69 R
4218 15067 2.133520 AGAATGAGTGGATGGGATGCT 58.866 47.619 0.0 0.0 0.0 3.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1859 9083 5.677344 GCTCAGACTACAGAACGATGATTCA 60.677 44.000 0.00 0.00 0.00 2.57
3106 11647 6.230849 TGAATGTCTCATTTTTGCAATTGC 57.769 33.333 23.69 23.69 42.50 3.56
3279 11822 7.848223 AAAAATCCTTTGGTTCACTTCAAAG 57.152 32.000 8.36 8.36 45.44 2.77
4346 15195 5.667626 ACTTCCTTCCTTGCTTCCTCATATA 59.332 40.000 0.00 0.00 0.00 0.86
4691 15577 5.746990 AGAACAACTTGATAGCCACTAGT 57.253 39.130 0.00 0.00 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1859 9083 2.311542 TGTGGTTAGAGGGAATGCCAAT 59.688 45.455 0.00 0.00 35.15 3.16
3106 11647 4.815269 ACAGAGAAAGAGGTGAAAGATCG 58.185 43.478 0.00 0.00 0.00 3.69
3266 11809 7.254227 TGTATGTGTTACTTTGAAGTGAACC 57.746 36.000 6.64 3.67 40.07 3.62
4218 15067 2.133520 AGAATGAGTGGATGGGATGCT 58.866 47.619 0.00 0.00 0.00 3.79
4346 15195 7.538678 GTCATTTGTGCGTGAAGAAGAAAATAT 59.461 33.333 0.00 0.00 0.00 1.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.