Multiple sequence alignment - TraesCS2B01G014400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G014400 chr2B 100.000 3403 0 0 1 3403 6902390 6898988 0.000000e+00 6285.0
1 TraesCS2B01G014400 chr2B 99.035 3419 15 3 1 3403 6814927 6811511 0.000000e+00 6115.0
2 TraesCS2B01G014400 chr2B 98.713 3419 28 4 1 3403 6766991 6763573 0.000000e+00 6056.0
3 TraesCS2B01G014400 chr2B 89.995 2009 154 23 777 2762 6728490 6726506 0.000000e+00 2553.0
4 TraesCS2B01G014400 chr2B 92.391 552 26 3 2867 3403 166853808 166853258 0.000000e+00 773.0
5 TraesCS2B01G014400 chr2B 92.784 291 18 2 447 736 6729096 6728808 5.250000e-113 418.0
6 TraesCS2B01G014400 chr2B 79.882 338 59 7 691 1025 454696690 454697021 4.390000e-59 239.0
7 TraesCS2B01G014400 chr2B 79.412 340 60 8 689 1025 7156964 7156632 7.340000e-57 231.0
8 TraesCS2B01G014400 chr2B 82.061 262 35 10 193 449 784039998 784039744 2.660000e-51 213.0
9 TraesCS2B01G014400 chr2B 92.105 114 8 1 336 449 29713934 29713822 3.510000e-35 159.0
10 TraesCS2B01G014400 chr2B 77.119 236 36 8 200 420 240518923 240518691 1.660000e-23 121.0
11 TraesCS2B01G014400 chr2D 86.544 1033 100 15 1671 2678 4387377 4388395 0.000000e+00 1101.0
12 TraesCS2B01G014400 chr2D 86.447 1033 101 15 1671 2678 4330659 4331677 0.000000e+00 1096.0
13 TraesCS2B01G014400 chr2D 86.447 1033 101 15 1671 2678 4355853 4356871 0.000000e+00 1096.0
14 TraesCS2B01G014400 chr2D 82.602 1276 171 28 1465 2728 4317884 4319120 0.000000e+00 1079.0
15 TraesCS2B01G014400 chr2D 86.811 599 70 8 447 1037 4329497 4330094 0.000000e+00 660.0
16 TraesCS2B01G014400 chr2D 86.811 599 70 8 447 1037 4354691 4355288 0.000000e+00 660.0
17 TraesCS2B01G014400 chr2D 86.811 599 70 8 447 1037 4386215 4386812 0.000000e+00 660.0
18 TraesCS2B01G014400 chr2D 90.928 485 43 1 1093 1576 4330173 4330657 0.000000e+00 651.0
19 TraesCS2B01G014400 chr2D 90.928 485 43 1 1093 1576 4386891 4387375 0.000000e+00 651.0
20 TraesCS2B01G014400 chr2D 90.722 485 44 1 1093 1576 4355367 4355851 0.000000e+00 645.0
21 TraesCS2B01G014400 chr2D 83.008 718 99 15 2018 2728 4343393 4344094 2.230000e-176 628.0
22 TraesCS2B01G014400 chr2D 83.008 718 99 15 2018 2728 4375143 4375844 2.230000e-176 628.0
23 TraesCS2B01G014400 chr2D 88.121 463 39 10 1 449 578330846 578331306 1.390000e-148 536.0
24 TraesCS2B01G014400 chr2D 85.683 461 47 7 2 449 95716321 95716775 5.140000e-128 468.0
25 TraesCS2B01G014400 chr2D 85.000 460 54 4 4 449 464611224 464610766 1.440000e-123 453.0
26 TraesCS2B01G014400 chr2D 80.060 336 62 4 691 1025 4030992 4031323 9.430000e-61 244.0
27 TraesCS2B01G014400 chrUn 82.759 1276 169 28 1465 2728 316738505 316739741 0.000000e+00 1090.0
28 TraesCS2B01G014400 chrUn 91.833 551 29 3 2868 3403 47795987 47795438 0.000000e+00 754.0
29 TraesCS2B01G014400 chr5B 92.740 551 23 4 2868 3403 565884865 565885413 0.000000e+00 780.0
30 TraesCS2B01G014400 chr5B 91.848 552 30 2 2867 3403 554167126 554167677 0.000000e+00 756.0
31 TraesCS2B01G014400 chr5B 90.661 514 22 5 2905 3403 314274041 314273539 0.000000e+00 660.0
32 TraesCS2B01G014400 chr1D 92.143 560 22 8 2864 3403 451950286 451949729 0.000000e+00 771.0
33 TraesCS2B01G014400 chr4B 92.377 551 25 4 2868 3403 657081324 657080776 0.000000e+00 769.0
34 TraesCS2B01G014400 chr4B 91.164 464 27 9 1 450 569969164 569968701 4.820000e-173 617.0
35 TraesCS2B01G014400 chr7D 91.921 557 23 5 2868 3403 619050456 619051011 0.000000e+00 760.0
36 TraesCS2B01G014400 chr7D 90.689 537 47 2 2867 3403 632979148 632978615 0.000000e+00 712.0
37 TraesCS2B01G014400 chr7D 88.868 539 54 6 2867 3403 416231955 416231421 0.000000e+00 658.0
38 TraesCS2B01G014400 chr7D 86.207 464 49 6 1 450 83554851 83555313 3.950000e-134 488.0
39 TraesCS2B01G014400 chr1B 92.015 551 28 3 2868 3403 656147850 656147301 0.000000e+00 760.0
40 TraesCS2B01G014400 chr1B 89.849 463 33 7 1 449 42577761 42578223 1.760000e-162 582.0
41 TraesCS2B01G014400 chr3D 91.018 501 24 5 2923 3403 45732568 45732069 0.000000e+00 656.0
42 TraesCS2B01G014400 chr7B 84.698 464 55 8 1 449 7172251 7171789 1.860000e-122 449.0
43 TraesCS2B01G014400 chr5D 83.588 262 30 12 193 449 483741781 483742034 2.040000e-57 233.0
44 TraesCS2B01G014400 chr4D 89.881 168 17 0 282 449 2552476 2552643 2.060000e-52 217.0
45 TraesCS2B01G014400 chr5A 86.441 118 11 5 338 454 495420185 495420072 1.280000e-24 124.0
46 TraesCS2B01G014400 chr2A 74.164 329 60 13 146 456 93121664 93121343 2.780000e-21 113.0
47 TraesCS2B01G014400 chr2A 89.831 59 6 0 392 450 720344872 720344814 3.640000e-10 76.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G014400 chr2B 6898988 6902390 3402 True 6285.000000 6285 100.000000 1 3403 1 chr2B.!!$R3 3402
1 TraesCS2B01G014400 chr2B 6811511 6814927 3416 True 6115.000000 6115 99.035000 1 3403 1 chr2B.!!$R2 3402
2 TraesCS2B01G014400 chr2B 6763573 6766991 3418 True 6056.000000 6056 98.713000 1 3403 1 chr2B.!!$R1 3402
3 TraesCS2B01G014400 chr2B 6726506 6729096 2590 True 1485.500000 2553 91.389500 447 2762 2 chr2B.!!$R9 2315
4 TraesCS2B01G014400 chr2B 166853258 166853808 550 True 773.000000 773 92.391000 2867 3403 1 chr2B.!!$R6 536
5 TraesCS2B01G014400 chr2D 4317884 4319120 1236 False 1079.000000 1079 82.602000 1465 2728 1 chr2D.!!$F2 1263
6 TraesCS2B01G014400 chr2D 4386215 4388395 2180 False 804.000000 1101 88.094333 447 2678 3 chr2D.!!$F9 2231
7 TraesCS2B01G014400 chr2D 4329497 4331677 2180 False 802.333333 1096 88.062000 447 2678 3 chr2D.!!$F7 2231
8 TraesCS2B01G014400 chr2D 4354691 4356871 2180 False 800.333333 1096 87.993333 447 2678 3 chr2D.!!$F8 2231
9 TraesCS2B01G014400 chr2D 4343393 4344094 701 False 628.000000 628 83.008000 2018 2728 1 chr2D.!!$F3 710
10 TraesCS2B01G014400 chr2D 4375143 4375844 701 False 628.000000 628 83.008000 2018 2728 1 chr2D.!!$F4 710
11 TraesCS2B01G014400 chrUn 316738505 316739741 1236 False 1090.000000 1090 82.759000 1465 2728 1 chrUn.!!$F1 1263
12 TraesCS2B01G014400 chrUn 47795438 47795987 549 True 754.000000 754 91.833000 2868 3403 1 chrUn.!!$R1 535
13 TraesCS2B01G014400 chr5B 565884865 565885413 548 False 780.000000 780 92.740000 2868 3403 1 chr5B.!!$F2 535
14 TraesCS2B01G014400 chr5B 554167126 554167677 551 False 756.000000 756 91.848000 2867 3403 1 chr5B.!!$F1 536
15 TraesCS2B01G014400 chr5B 314273539 314274041 502 True 660.000000 660 90.661000 2905 3403 1 chr5B.!!$R1 498
16 TraesCS2B01G014400 chr1D 451949729 451950286 557 True 771.000000 771 92.143000 2864 3403 1 chr1D.!!$R1 539
17 TraesCS2B01G014400 chr4B 657080776 657081324 548 True 769.000000 769 92.377000 2868 3403 1 chr4B.!!$R2 535
18 TraesCS2B01G014400 chr7D 619050456 619051011 555 False 760.000000 760 91.921000 2868 3403 1 chr7D.!!$F2 535
19 TraesCS2B01G014400 chr7D 632978615 632979148 533 True 712.000000 712 90.689000 2867 3403 1 chr7D.!!$R2 536
20 TraesCS2B01G014400 chr7D 416231421 416231955 534 True 658.000000 658 88.868000 2867 3403 1 chr7D.!!$R1 536
21 TraesCS2B01G014400 chr1B 656147301 656147850 549 True 760.000000 760 92.015000 2868 3403 1 chr1B.!!$R1 535

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
494 508 2.16503 CCCAACCAATCTCATGTCTTGC 59.835 50.0 0.0 0.0 0.0 4.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2851 3216 5.204409 TCCAACAAGTTGTACACGTCTAT 57.796 39.13 9.37 0.0 38.85 1.98 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
98 99 9.563345 TCTTGCGTAAGAATGTTGTAGCACAAC 62.563 40.741 13.91 19.09 46.57 3.32
494 508 2.165030 CCCAACCAATCTCATGTCTTGC 59.835 50.000 0.00 0.00 0.00 4.01
1091 1421 1.652947 TCTAAGGAAAAGAGGCGGGT 58.347 50.000 0.00 0.00 0.00 5.28
1178 1509 0.681887 TTCCATCACCGCCTCGACTA 60.682 55.000 0.00 0.00 0.00 2.59
2412 2751 5.591472 TCCAAAGTTGCATAGATCAATGGAG 59.409 40.000 0.00 0.00 30.78 3.86
2597 2962 9.236691 CATTGGAATAAATAATTTGTCTCACGG 57.763 33.333 0.00 0.00 0.00 4.94
2851 3216 6.388619 AGGCTAGAGGAATGGAAAAACTAA 57.611 37.500 0.00 0.00 0.00 2.24
3075 3456 2.224402 GCAAAGACTGGACCTGAACTCT 60.224 50.000 5.22 0.00 0.00 3.24
3371 3827 3.532155 GGCACTCGAGCGGGAGAT 61.532 66.667 13.61 0.00 37.49 2.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
98 99 3.006247 GGCTTGAAGGACTAGAGCAAAG 58.994 50.000 0.00 0.0 35.12 2.77
307 308 3.609853 TGCCGTCAGCTTTTCATTAGAT 58.390 40.909 0.00 0.0 44.23 1.98
494 508 6.292008 CGTATTTATGGATCAGATATGCAGCG 60.292 42.308 0.00 0.0 0.00 5.18
1091 1421 6.092944 CGCCTTACCTGTGTTGAAACATATTA 59.907 38.462 0.00 0.0 41.59 0.98
1178 1509 1.133823 TGTGAGGTTGACAATGGTGCT 60.134 47.619 0.00 0.0 0.00 4.40
2851 3216 5.204409 TCCAACAAGTTGTACACGTCTAT 57.796 39.130 9.37 0.0 38.85 1.98
2930 3298 1.271871 TGGCCCACCTTGTACTTCATG 60.272 52.381 0.00 0.0 36.63 3.07
3075 3456 2.891580 ACTGCCTACTTCTGTCTTCGAA 59.108 45.455 0.00 0.0 0.00 3.71
3234 3660 1.069432 GTCTACTGCGACAACGTCTCA 60.069 52.381 0.00 0.0 41.98 3.27
3371 3827 1.461268 TCCAAGAGACAGCCCACCA 60.461 57.895 0.00 0.0 0.00 4.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.