Multiple sequence alignment - TraesCS2B01G014200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G014200 chr2B 100.000 3645 0 0 1 3645 6828339 6824695 0.000000e+00 6732.0
1 TraesCS2B01G014200 chr2B 99.726 3645 10 0 1 3645 6915801 6912157 0.000000e+00 6676.0
2 TraesCS2B01G014200 chr2B 99.616 3645 13 1 1 3645 6780361 6776718 0.000000e+00 6652.0
3 TraesCS2B01G014200 chr2B 94.655 2750 122 13 651 3388 454670553 454667817 0.000000e+00 4241.0
4 TraesCS2B01G014200 chr2B 91.271 2761 219 9 803 3559 6732589 6729847 0.000000e+00 3744.0
5 TraesCS2B01G014200 chr2B 90.339 1149 87 10 2252 3388 7238087 7239223 0.000000e+00 1485.0
6 TraesCS2B01G014200 chr2B 96.220 635 4 2 1 635 7223995 7224609 0.000000e+00 1022.0
7 TraesCS2B01G014200 chr2B 96.220 635 4 2 1 635 454671155 454670541 0.000000e+00 1022.0
8 TraesCS2B01G014200 chr2B 95.455 88 3 1 3551 3637 6729679 6729592 4.910000e-29 139.0
9 TraesCS2B01G014200 chrUn 95.508 2360 87 10 651 3000 337610555 337612905 0.000000e+00 3753.0
10 TraesCS2B01G014200 chrUn 100.000 1342 0 0 1 1342 339339630 339338289 0.000000e+00 2479.0
11 TraesCS2B01G014200 chrUn 100.000 384 0 0 2679 3062 480930273 480930656 0.000000e+00 710.0
12 TraesCS2B01G014200 chrUn 97.110 173 1 2 464 635 337610398 337610567 4.610000e-74 289.0
13 TraesCS2B01G014200 chr2D 90.993 2176 183 6 673 2837 4326043 4328216 0.000000e+00 2920.0
14 TraesCS2B01G014200 chr2D 90.947 2176 184 6 673 2837 4351237 4353410 0.000000e+00 2915.0
15 TraesCS2B01G014200 chr2D 90.947 2176 184 6 673 2837 4382761 4384934 0.000000e+00 2915.0
16 TraesCS2B01G014200 chr2D 90.539 761 66 5 2888 3645 4328217 4328974 0.000000e+00 1002.0
17 TraesCS2B01G014200 chr2D 90.539 761 66 5 2888 3645 4353411 4354168 0.000000e+00 1002.0
18 TraesCS2B01G014200 chr2D 90.539 761 66 5 2888 3645 4384935 4385692 0.000000e+00 1002.0
19 TraesCS2B01G014200 chr2D 83.677 631 35 27 88 678 4325384 4325986 1.930000e-147 532.0
20 TraesCS2B01G014200 chr2D 83.360 631 37 26 88 678 4350578 4351180 4.170000e-144 521.0
21 TraesCS2B01G014200 chr2D 83.360 631 37 26 88 678 4382102 4382704 4.170000e-144 521.0
22 TraesCS2B01G014200 chr2D 91.667 60 4 1 672 731 2014007 2014065 8.390000e-12 82.4
23 TraesCS2B01G014200 chr3B 82.993 1517 252 6 1054 2567 3412147 3410634 0.000000e+00 1367.0
24 TraesCS2B01G014200 chr7D 95.122 82 4 0 8 89 309501944 309501863 2.950000e-26 130.0
25 TraesCS2B01G014200 chr7B 95.122 82 4 0 8 89 304987230 304987311 2.950000e-26 130.0
26 TraesCS2B01G014200 chr4A 93.902 82 5 0 8 89 512543418 512543499 1.370000e-24 124.0
27 TraesCS2B01G014200 chr1B 93.902 82 5 0 8 89 67055018 67054937 1.370000e-24 124.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G014200 chr2B 6824695 6828339 3644 True 6732.000000 6732 100.0000 1 3645 1 chr2B.!!$R2 3644
1 TraesCS2B01G014200 chr2B 6912157 6915801 3644 True 6676.000000 6676 99.7260 1 3645 1 chr2B.!!$R3 3644
2 TraesCS2B01G014200 chr2B 6776718 6780361 3643 True 6652.000000 6652 99.6160 1 3645 1 chr2B.!!$R1 3644
3 TraesCS2B01G014200 chr2B 454667817 454671155 3338 True 2631.500000 4241 95.4375 1 3388 2 chr2B.!!$R5 3387
4 TraesCS2B01G014200 chr2B 6729592 6732589 2997 True 1941.500000 3744 93.3630 803 3637 2 chr2B.!!$R4 2834
5 TraesCS2B01G014200 chr2B 7238087 7239223 1136 False 1485.000000 1485 90.3390 2252 3388 1 chr2B.!!$F2 1136
6 TraesCS2B01G014200 chr2B 7223995 7224609 614 False 1022.000000 1022 96.2200 1 635 1 chr2B.!!$F1 634
7 TraesCS2B01G014200 chrUn 339338289 339339630 1341 True 2479.000000 2479 100.0000 1 1342 1 chrUn.!!$R1 1341
8 TraesCS2B01G014200 chrUn 337610398 337612905 2507 False 2021.000000 3753 96.3090 464 3000 2 chrUn.!!$F2 2536
9 TraesCS2B01G014200 chr2D 4325384 4328974 3590 False 1484.666667 2920 88.4030 88 3645 3 chr2D.!!$F2 3557
10 TraesCS2B01G014200 chr2D 4350578 4354168 3590 False 1479.333333 2915 88.2820 88 3645 3 chr2D.!!$F3 3557
11 TraesCS2B01G014200 chr2D 4382102 4385692 3590 False 1479.333333 2915 88.2820 88 3645 3 chr2D.!!$F4 3557
12 TraesCS2B01G014200 chr3B 3410634 3412147 1513 True 1367.000000 1367 82.9930 1054 2567 1 chr3B.!!$R1 1513

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1342 1472 1.047002 CAAACCATGCCAACTTCCCA 58.953 50.000 0.00 0.0 0.0 4.37 F
2180 2310 2.281070 CACCAGCGCCTGTCTTGT 60.281 61.111 2.29 0.0 0.0 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2327 2457 0.038166 AGGTTGTTGCCATCATCCGT 59.962 50.000 0.00 0.0 32.01 4.69 R
3064 3209 6.932400 TGACGAATTACACCACTAATTTGTCT 59.068 34.615 21.69 0.5 46.59 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1342 1472 1.047002 CAAACCATGCCAACTTCCCA 58.953 50.000 0.00 0.0 0.0 4.37
2180 2310 2.281070 CACCAGCGCCTGTCTTGT 60.281 61.111 2.29 0.0 0.0 3.16
3064 3209 3.665409 CGTTGAACTCGTAAAAGCGACTA 59.335 43.478 0.00 0.0 36.8 2.59
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1342 1472 2.340328 GGCGAATTCCGTGCCCTTT 61.340 57.895 10.78 0.0 43.06 3.11
2327 2457 0.038166 AGGTTGTTGCCATCATCCGT 59.962 50.000 0.00 0.0 32.01 4.69
3064 3209 6.932400 TGACGAATTACACCACTAATTTGTCT 59.068 34.615 21.69 0.5 46.59 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.