Multiple sequence alignment - TraesCS2B01G014000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G014000 chr2B 100.000 3645 0 0 1 3645 6780361 6776717 0.000000e+00 6732.0
1 TraesCS2B01G014000 chr2B 99.616 3646 13 1 1 3645 6828339 6824694 0.000000e+00 6654.0
2 TraesCS2B01G014000 chr2B 99.589 3646 14 1 1 3645 6915801 6912156 0.000000e+00 6649.0
3 TraesCS2B01G014000 chr2B 94.580 2749 125 13 651 3387 454670553 454667817 0.000000e+00 4229.0
4 TraesCS2B01G014000 chr2B 91.196 2760 222 7 803 3558 6732589 6729847 0.000000e+00 3731.0
5 TraesCS2B01G014000 chr2B 90.157 1148 90 10 2252 3387 7238087 7239223 0.000000e+00 1472.0
6 TraesCS2B01G014000 chr2B 96.220 635 4 2 1 635 7223995 7224609 0.000000e+00 1022.0
7 TraesCS2B01G014000 chr2B 96.220 635 4 2 1 635 454671155 454670541 0.000000e+00 1022.0
8 TraesCS2B01G014000 chr2B 95.455 88 3 1 3550 3636 6729679 6729592 4.910000e-29 139.0
9 TraesCS2B01G014000 chrUn 95.379 2359 91 10 651 2999 337610555 337612905 0.000000e+00 3736.0
10 TraesCS2B01G014000 chrUn 100.000 1342 0 0 1 1342 339339630 339338289 0.000000e+00 2479.0
11 TraesCS2B01G014000 chrUn 99.479 384 2 0 2678 3061 480930273 480930656 0.000000e+00 699.0
12 TraesCS2B01G014000 chrUn 97.110 173 1 2 464 635 337610398 337610567 4.610000e-74 289.0
13 TraesCS2B01G014000 chr2D 90.897 2175 186 5 673 2836 4326043 4328216 0.000000e+00 2909.0
14 TraesCS2B01G014000 chr2D 90.851 2175 187 5 673 2836 4351237 4353410 0.000000e+00 2904.0
15 TraesCS2B01G014000 chr2D 90.851 2175 187 5 673 2836 4382761 4384934 0.000000e+00 2904.0
16 TraesCS2B01G014000 chr2D 90.682 762 65 5 2887 3645 4328217 4328975 0.000000e+00 1009.0
17 TraesCS2B01G014000 chr2D 90.682 762 65 5 2887 3645 4353411 4354169 0.000000e+00 1009.0
18 TraesCS2B01G014000 chr2D 90.682 762 65 5 2887 3645 4384935 4385693 0.000000e+00 1009.0
19 TraesCS2B01G014000 chr2D 83.677 631 35 27 88 678 4325384 4325986 1.930000e-147 532.0
20 TraesCS2B01G014000 chr2D 83.360 631 37 26 88 678 4350578 4351180 4.170000e-144 521.0
21 TraesCS2B01G014000 chr2D 83.360 631 37 26 88 678 4382102 4382704 4.170000e-144 521.0
22 TraesCS2B01G014000 chr2D 91.667 60 4 1 672 731 2014007 2014065 8.390000e-12 82.4
23 TraesCS2B01G014000 chr2A 81.438 1627 286 11 1054 2669 2876208 2877829 0.000000e+00 1317.0
24 TraesCS2B01G014000 chr7D 95.122 82 4 0 8 89 309501944 309501863 2.950000e-26 130.0
25 TraesCS2B01G014000 chr7B 95.122 82 4 0 8 89 304987230 304987311 2.950000e-26 130.0
26 TraesCS2B01G014000 chr4A 93.902 82 5 0 8 89 512543418 512543499 1.370000e-24 124.0
27 TraesCS2B01G014000 chr1B 93.902 82 5 0 8 89 67055018 67054937 1.370000e-24 124.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G014000 chr2B 6776717 6780361 3644 True 6732.000000 6732 100.000000 1 3645 1 chr2B.!!$R1 3644
1 TraesCS2B01G014000 chr2B 6824694 6828339 3645 True 6654.000000 6654 99.616000 1 3645 1 chr2B.!!$R2 3644
2 TraesCS2B01G014000 chr2B 6912156 6915801 3645 True 6649.000000 6649 99.589000 1 3645 1 chr2B.!!$R3 3644
3 TraesCS2B01G014000 chr2B 454667817 454671155 3338 True 2625.500000 4229 95.400000 1 3387 2 chr2B.!!$R5 3386
4 TraesCS2B01G014000 chr2B 6729592 6732589 2997 True 1935.000000 3731 93.325500 803 3636 2 chr2B.!!$R4 2833
5 TraesCS2B01G014000 chr2B 7238087 7239223 1136 False 1472.000000 1472 90.157000 2252 3387 1 chr2B.!!$F2 1135
6 TraesCS2B01G014000 chr2B 7223995 7224609 614 False 1022.000000 1022 96.220000 1 635 1 chr2B.!!$F1 634
7 TraesCS2B01G014000 chrUn 339338289 339339630 1341 True 2479.000000 2479 100.000000 1 1342 1 chrUn.!!$R1 1341
8 TraesCS2B01G014000 chrUn 337610398 337612905 2507 False 2012.500000 3736 96.244500 464 2999 2 chrUn.!!$F2 2535
9 TraesCS2B01G014000 chr2D 4325384 4328975 3591 False 1483.333333 2909 88.418667 88 3645 3 chr2D.!!$F2 3557
10 TraesCS2B01G014000 chr2D 4350578 4354169 3591 False 1478.000000 2904 88.297667 88 3645 3 chr2D.!!$F3 3557
11 TraesCS2B01G014000 chr2D 4382102 4385693 3591 False 1478.000000 2904 88.297667 88 3645 3 chr2D.!!$F4 3557
12 TraesCS2B01G014000 chr2A 2876208 2877829 1621 False 1317.000000 1317 81.438000 1054 2669 1 chr2A.!!$F1 1615

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1839 1972 3.118956 AGGAAGATCACCTCATGTCGTTC 60.119 47.826 5.77 0.0 31.43 3.95 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3227 3380 4.254492 GTGGCCTCTACGAAGAAGAAAAT 58.746 43.478 3.32 0.0 0.0 1.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1839 1972 3.118956 AGGAAGATCACCTCATGTCGTTC 60.119 47.826 5.77 0.0 31.43 3.95
2280 2413 0.046242 TCCATGGGGAGAATGGAGGT 59.954 55.000 13.02 0.0 46.88 3.85
2335 2468 1.271934 CATAGGTGGCTCTCGGATGAG 59.728 57.143 0.00 0.0 43.99 2.90
2474 2607 3.502211 GGTGTGGAACTTCGATGTGAATT 59.498 43.478 4.52 0.0 38.04 2.17
2560 2693 8.594881 TCATTGTTAAGTTGAAGAAGAGAGAC 57.405 34.615 0.00 0.0 0.00 3.36
2831 2976 1.303317 GTGACCCAACCGGCTCAAT 60.303 57.895 0.00 0.0 33.26 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1839 1972 1.542915 CTTGTTCCTTGCCATGTCCAG 59.457 52.381 0.00 0.0 0.00 3.86
2075 2208 1.580059 AAGATCACCGGGGTACACAT 58.420 50.000 2.12 0.0 0.00 3.21
2280 2413 1.477923 GGCAGTCTTTACCCCACACAA 60.478 52.381 0.00 0.0 0.00 3.33
2335 2468 0.958382 TGTATCGCAGGTTGTTGCCC 60.958 55.000 0.00 0.0 41.01 5.36
2474 2607 1.792757 ATGCTCTGCCCTTCCACCAA 61.793 55.000 0.00 0.0 0.00 3.67
2831 2976 5.472137 GTGCTTATCTACTGGGAAAACAACA 59.528 40.000 0.00 0.0 0.00 3.33
3227 3380 4.254492 GTGGCCTCTACGAAGAAGAAAAT 58.746 43.478 3.32 0.0 0.00 1.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.